Phenacoccus solani

Ferris, 1918 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pseudococcidae/Phenacoccus

At a glance

Occurrence records55

Data sources9

Biological traits0

DNA specimens111

eDNA detections84

Sources9 archives

Databases and archives Phenacoccus solani's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility55 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI84 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics111 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF55 records

Environmental DNA1 datasets · 6 countries84 detections

DNA & barcodingBOLD111 specimens

Genome at a glanceGoaT · TreeOfSex2n = 10

01Narrative

Phenacoccus solani, the solanum mealybug, is a species of mealybug in the family Pseudococcidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding111 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phenacoccus solani has left across the world's sequence archives.

At a glance

DNA specimens111

BINs1

Marker genes3

eDNA detections84

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

10Tvariable

34Tmostly conserved

49Tmostly conserved

115Cvariable

160Amostly conserved

178Tmostly conserved

197Tvariable

199Amostly conserved

214Tvariable

220Tmostly conserved

235Tvariable

238Tmostly conserved

247Tmostly conserved

259Tvariable

277Tmostly conserved

310Tmostly conserved

325Avariable

340Tmostly conserved

343Avariable

364Tmostly conserved

370Tvariable

388Tmostly conserved

392Tmostly conserved

394Amostly conserved

403Tmostly conserved

406Tmostly conserved

407Tmostly conserved

412Amostly conserved

430Tmostly conserved

452Gmostly conserved

454Amostly conserved

469Tmostly conserved

476Tmostly conserved

478Amostly conserved

490Tmostly conserved

538Tmostly conserved

545Gvariable

547Tmostly conserved

553Tvariable

559Amostly conserved

610Tmostly conserved

628Amostly conserved

AATACTTTATTTAATTTTTGGATTTTGATCAGGTTTAATAGGATTATCTATATCATTAATTATTCGTATTGAATTAATTAATATAAATAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes9

BIN1

Most divergent pair5.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phenacoccus solenopsissame genus4.9%Ferrisia dasyliriisame family9.4%Pseudococcus jackbeardsleyisame family10.8%Phenacoccus acerissame genus10.9%Spilococcus mamillariaesame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Phenacoccus solani carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–102n range10median10mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 102×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gavrilov, I. (2007). A catalog of chromosome numbers and genetic systems of scale insects (Homoptera: Coccinea) of the world. Isr. J. Entomol, 37, 1-45. ↗

08Occurrence & distribution

Record type55 records

Wild obs. + sensor12

Museum / vouchered41

Other2

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤1 km 1>10 km 9

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 41 records without

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Universidad Nacional de Colombia (UNAL)location not on record	26
Guangdong Inspection and Quarantine Technology Centerlocation not on record	2

2 institutions · 28 of 41 vouchered records shown · 12 without an institution code

09Environmental DNA84 detections

Where the DNA of Phenacoccus solani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found84

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 84 detections have coordinates

Open the map6 countries0

Mango

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 10.0–27.9

Seasonal swing summer↔winter14.9 °C

Max temp (day)28.3 °C 15.7–30.1

Min temp (night)18.4 °C 3.10–25.9

Precipitation71.6 mm/mo 0–271

Air humidity57.6 % 46.7–66.1

Moisture balance-34.0 mm/mo

Vapour deficit1,288 Pa 757–1,551

Wind speed4.20 m/s

Cloud cover32.7 % 11.3–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)