Phellinidium ferrugineofuscum

(P.Karst.) Fiasson & Niemelä · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Hymenochaetales/Hymenochaetaceae/Phellinidium

At a glance

Occurrence records70 976

Data sources7

Biological traits0

DNA specimens0

eDNA detections46

Sources7 archives

Databases and archives Phellinidium ferrugineofuscum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 976 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF70 976 records

Environmental DNA3 datasets · 8 countries46 detections

DNA & barcodingNCBIsequences

01Narrative

Phellinidium ferrugineofuscum is a species of fungus belonging to the family Hymenochaetaceae. It is native to Eurasia and Northern America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phellinidium ferrugineofuscum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections46

Countries8

The DNA barcodea real sequence read deposited for this species

ITSMW358387.1 ↗392 bpFinland · 2014

ACGT

CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCT …

Phellinidium ferrugineofuscum voucher IssPhefer1(A011) 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type70 976 records

Wild obs. + sensor70 517

Museum / vouchered458

Cultivated / captive1

Range

Area of Occupancy AOO79 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 59 895≤1 km 9 997≤10 km 472>10 km 12

70 376 georeferenced · 141 without coordinates

Open the mapobservation + sensor70 517

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 50≤1 km 133≤10 km 144>10 km 13

340 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence458

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	276
Copenhagen, DK	34
Uppsala, SE	10
Mlocation not on record	8
Göteborg, SE	8
Tartu, EE	5
Toronto, CA	5
Philadelphia, US	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Museo Entomologico de Leonlocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Zürich, CH	1
Cincinnati, US	1
WTUlocation not on record	1
UNINE:NEUlocation not on record	1
LDlocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1

17 institutions · 361 of 458 vouchered records shown · 97 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA46 detections

Where the DNA of Phellinidium ferrugineofuscum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys3

Countries8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map8 countries0

On rather fresh Picea log, decay grade 2; mi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 4.10–17.0

Seasonal swing summer↔winter22.4 °C

Max temp (day)17.7 °C 6.90–20.7

Min temp (night)8.20 °C 0.2–12.5

Precipitation79.0 mm/mo 38.0–124

Air humidity59.6 % 56.6–67.7

Moisture balance4.10 mm/mo -51.8–63.6

Vapour deficit664 Pa 281–792

Wind speed2.70 m/s 1.90–3.90

Cloud cover42.9 % 37.7–61.0

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phellinidium ferrugineofuscum

At a glance

Sources7 archives

At a glance

Record type70 976 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type70 976 records