Phallus rubicundus

(Bosc) Fr. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Phallales/Phallaceae/Phallus

At a glance

Occurrence records380

Data sources8

Biological traits0

DNA specimens0

eDNA detections2

Sources8 archives

Databases and archives Phallus rubicundus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF380 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Phallus rubicundus is a species of fungus in the stinkhorn family. First described in 1811, it has a wide distribution in tropical regions. It has the typical stinkhorn structure consisting of a spongy stalk up to 15 cm tall arising from a gelatinous "egg" up to 3 cm in diameter. Atop the stalk is a pitted, conical cap that has a foul-smelling, gelatinous, green spore mass spread over it.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phallus rubicundus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections2

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOR434608.1 ↗443 bpSingapore · 2023

ACGT

TTCCGGAGAGCGCTCGCCCTTCTTTCACGATTCAAACGCCCCGTGCACTCTCGAGGGAACCTCACCGTTCTCTCGCTTTGAAAACGCCCT …

Phallus rubicundus voucher SL2040 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type380 records

Wild obs. + sensor273

Museum / vouchered86

Other21

Origin

Native2

Range

Area of Occupancy AOO1 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 23≤1 km 43≤10 km 42>10 km 8

116 georeferenced · 157 without coordinates

Open the mapobservation + sensor273

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 12≤1 km 24≤10 km 18>10 km 9

63 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	20
Brisbane, AU	17
DPIlocation not on record	7
Museo Entomologico de Leonlocation not on record	6
Bronx, US	5
Chicago, US	4
Bernard Price Institute for Palaeontological Researchlocation not on record	4
Colorado State Universitylocation not on record	4
Lincoln, US	2
MeiseBGlocation not on record	2
Brown Universitylocation not on record	1
Logan, US	1
Tampa, US	1
Ann Arbor, US	1
IPA/SPlocation not on record	1
Chapel Hill, US	1
Adelaide, AU	1
Catholic University of Pekinglocation not on record	1
PHlocation not on record	1
ILLSlocation not on record	1

20 institutions · 81 of 86 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Phallus rubicundus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Birch(Hardwood) dowel buried in soil of a co…Spruce(Softwood) dowel buried in soil of a c…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter26.8 °C

Max temp (day)17.4 °C

Min temp (night)10.8 °C

Precipitation102 mm/mo

Air humidity60.9 %

Moisture balance8.00 mm/mo

Vapour deficit647 Pa

Wind speed2.40 m/s

Cloud cover58.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)