Phallus multicolor

(Berk. & Broome) Cooke, 1882 · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Phallales/Phallaceae/Phallus

At a glance

Occurrence records1 384

Data sources6

Biological traits0

DNA specimens0

eDNA detections447

Sources6 archives

Databases and archives Phallus multicolor's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 384 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI447 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 384 records

Environmental DNA5 datasets · 5 countries447 detections

DNA & barcodingNCBIsequences

01Narrative

Phallus multicolor is a species of fungus in the family Phallaceae or "stinkhorns".

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phallus multicolor has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

eDNA detections447

Countries5

The DNA barcodea real sequence read deposited for this species

ITSOQ202235.1 ↗420 bpIndia · 2014

ACGT

GAACGCCTCGCAGTCTCGCGCGTGTCAGTGAAATAAACGAAATCGAAACACAACTTTCAACAACGGATCTCTTGGCTTTCGCATCGATGA …

Phallus multicolor isolate KSRF-0004 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type1 384 records

Wild obs. + sensor1 337

Museum / vouchered42

Other5

Origin

Native4

Range

Area of Occupancy AOO3 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 680≤1 km 200≤10 km 94>10 km 94

1 068 georeferenced · 269 without coordinates

Open the mapobservation + sensor1 337

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 15≤1 km 4≤10 km 13>10 km 3

35 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	20
Museo Entomologico de Leonlocation not on record	8
Palmerston, AU	4
Canberra, AU	2
Parkville, AU	1
EcoFoG FunGuy collectionlocation not on record	1
Kensington, AU	1
DPIlocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1

9 institutions · 39 of 42 vouchered records shown · 3 without an institution code

09Environmental DNA447 detections

Where the DNA of Phallus multicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found447

Studies independent surveys5

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 447 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature23.0 °C 11.0–29.0

pH5.95 3.40–9.00

Conductivity44.5 µS/cm 12.0–392

Organic carbon0.795 % 0.25–5.38

Water content68.2 % 4.43–130

Nitrate-N2.00 mg/kg 1.00–209

Phosphorus18.0 mg/kg 6.00–432

Clay20.3 % 4.89–65.7

Sand68.0 % 15.5–94.1

Depth0 m 0–0.2

SoilMarineTenosolVertosolHydrosolChromosolCalcarosolDermosol

76 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 12.5–26.1

Seasonal swing summer↔winter8.10 °C

Max temp (day)27.8 °C 17.8–28.9

Min temp (night)22.9 °C 7.10–24.1

Precipitation277 mm/mo 43.9–602

Air humidity64.4 % 56.8–65.8

Moisture balance122 mm/mo

Vapour deficit1,148 Pa 623–1,192

Wind speed3.00 m/s

Cloud cover53.6 % 12.7–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 447 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phallus multicolor

At a glance

Sources6 archives

At a glance

Record type1 384 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 384 records