Phallus cinnabarinus — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Phallales/Phallaceae/Phallus

At a glance

Occurrence records30

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Phallus cinnabarinus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility30 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF30 records

DNA & barcodingNCBIsequences

01Narrative

Phallus cinnabarinus is a species of fungus in the stinkhorn family. Originally named in 1957 as Dictyophora cinnabarina, it was transferred to the genus Phallus in 1996 by Hanns Kreisel. It is found in Taiwan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phallus cinnabarinus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMG678533.1 ↗473 bp

ACGT

TTCATTTGTGGGGGGGTGGAGAGGCGACTCTCTCCCCCCCGACCGACACCTCCGTGCACTCTGGTCTGGAAAGGAGAGCCCTCCTGTTTA …

Phallus cinnabarinus voucher INPA255836 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor29

Museum / vouchered1

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 8≤1 km 6≤10 km 6>10 km 3

23 georeferenced · 6 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1

1 institutions · 1 of 1 vouchered records shown