Phallogaster saccatus

Morgan · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Hysterangiales/Phallogastraceae/Phallogaster

At a glance

Occurrence records183

Data sources8

Biological traits0

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Phallogaster saccatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF183 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Phallogaster Morgan – rodzaj grzybów z rodziny Phallogastraceae. W Polsce występuje jeden gatunek.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phallogaster saccatus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJF908778.1 ↗278 bpItaly · 1986

ACGT

ATCATTACAGTATTTCAGAGGGGTTAGATGCTGGCTTCGGCACGTGCGCGCCCCTCGATTACATTTCCACTTACACCTGTGAACACAGCT …

Phallogaster saccatus voucher 17061 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type183 records

Wild obs. + sensor89

Museum / vouchered92

Other2

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 8≤1 km 7≤10 km 43>10 km 3

61 georeferenced · 28 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 12≤10 km 32>10 km 4

51 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	12
Bernard Price Institute for Palaeontological Researchlocation not on record	11
Bronx, US	8
BDBClocation not on record	6
Catholic University of Pekinglocation not on record	6
WU-MYClocation not on record	6
Uniwersytet Jagiellońskilocation not on record	5
Université de Montréal Biodiversity Centrelocation not on record	5
TENN-Flocation not on record	4
National Biodiversity Institute, Costa Ricalocation not on record	4
Davis and Elkins Collegelocation not on record	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
Chapel Hill, US	2
Copenhagen, DK	2
Zürich, CH	2
CA	1
GJOlocation not on record	1
Lincoln, US	1
ILLSlocation not on record	1
Toronto, CA	1
WTUlocation not on record	1
MUSE - Museo delle Scienze di Trentolocation not on record	1
Karlsruhe, DE	1

24 institutions · 90 of 92 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Phallogaster saccatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 13.9–17.9

Seasonal swing summer↔winter21.4 °C

Max temp (day)19.2 °C 17.3–21.1

Min temp (night)9.80 °C 7.80–11.7

Precipitation110 mm/mo 97.0–122

Air humidity58.7 % 57.6–59.8

Moisture balance2.90 mm/mo -15.5–21.4

Vapour deficit762 Pa 648–875

Wind speed1.30 m/s 1.20–1.40

Cloud cover39.3 % 39.2–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)