Phalaris lemmonii

Vasey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Phalaris

At a glance

Occurrence records460

Data sources11

Biological traits17

DNA specimens7

eDNA detections4

Sources11 archives

Databases and archives Phalaris lemmonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility460 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF460 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Phalaris lemmonii is an uncommon species of grass known by the common name Lemmon's canarygrass. It is endemic to California, where it can be found in coastal and inland mountain ranges and the Central Valley.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length100 mm

Leaf width4.5 mm

Plant height0.875 m

Seed mass1.23 mg

Seed mass max1.23 mg

Seed mass min1.23 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phalaris lemmonii has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences7

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJF951082.1 ↗590 bpUSA

ACGT

ACCCTGACCAAAACAGACCGTGCACGCGTCCTCTAGCTAGCCGGCGGTGGCAATGTTCATCGCTCGGCAAAGTCCTCGATAACCTACTCT …

Phalaris lemmonii isolate LEM434 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phalaris lemmonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Parthasarathy 1938

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type460 records

Wild obs. + sensor25

Museum / vouchered435

Origin

Introduced6

Range

Area of Occupancy AOO1 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 11≤10 km 1>10 km 2

14 georeferenced · 11 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 3≤1 km 156≤10 km 123>10 km 7

289 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence435

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	95
Santa Barbara, US	47
Riverside, US	44
Claremont, US	41
San Diego, US	30
US	22
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	11
San Luis Obispo, US	10
Fredericton Stock Culture Collectionlocation not on record	9
Canadian Department of Agriculturelocation not on record	8
CASlocation not on record	7
Los Angeles, US	6
Museo Entomologico de Leonlocation not on record	5
South Kensington, GB	4
Santa Cruz, US	4
Severin-McDaniel Insect Collectionlocation not on record	4
Chongqing Museumlocation not on record	3
Arcata, US	3
Istituto Agrario Castelnuovolocation not on record	3
ASUlocation not on record	2
Northridge, US	2
Irvine, US	2
Provo, US	2
Bloomington, US	2
Logan, US	2
Dresden, DE	1
Auckland, NZ	1
Long Beach, US	1
Saint Louis, US	1
Tampa, US	1
San Diego Natural History Museumlocation not on record	1
Mount Annan, AU	1
San Jose, US	1
Philadelphia, US	1
Denver, US	1
Berlin, DE	1
DOI/NPS, Greenbelt Parklocation not on record	1
EL PASO, US	1

38 institutions · 381 of 435 vouchered records shown · 52 without an institution code

09Environmental DNA4 detections

Where the DNA of Phalaris lemmonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Valley and foothill grassland.|Bosanko clay …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–14.7

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C 18.4–21.2

Min temp (night)8.20 °C 8.20–9.00

Precipitation79.6 mm/mo 45.6–79.6

Air humidity57.3 % 57.3–58.3

Moisture balance-38.4 mm/mo -74.5–-38.4

Vapour deficit733 Pa 724–733

Wind speed5.80 m/s 2.10–5.80

Cloud cover36.7 % 33.4–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)