Phaeolepiota aurea

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Tricholomataceae/Phaeolepiota

At a glance

Occurrence records3 641

Data sources9

Biological traits0

DNA specimens11

eDNA detections35

Sources9 archives

Databases and archives Phaeolepiota aurea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 641 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS16 compounds

Occurrence & distributionGBIF3 641 records

Environmental DNA4 datasets · 5 countries35 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceGoaT · NCBI≈34 Mbp

01Narrative

Aksamitkówka złota – gatunek grzybów z rzędu pieczarkowców (Agaricales).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition16 compounds

Compounds documented for Phaeolepiota aurea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Polyprenol derivatives10

Kavalactones and derivatives2

Fatty alcohols1

Ergostane steroids1

Linear diarylheptanoids1

Documented compounds16 total

Compound	Amount	Source
(2R,3R,7R,11R,15R,19R,23R,27R,31R,35R)-3,7,11,15,19,23,27,31,35,39-decamethyltetracontane-1,2,3,7,11,15,19,23,27,31,35,39-dodecol	present	LOTUS
(2R,3R,7R,11R,15R,19R,23R,27R,31R,35R,39R)-3,7,11,15,19,23,27,31,35,39,43-undecamethyltetratetracontane-1,2,3,7,11,15,19,23,27,31,35,39,43-tridecol	present	LOTUS
(2R,3R,7R,11R,15R,19R,23R,27R,31R,35R,39R,43R)-3,7,11,15,19,23,27,31,35,39,43,47-dodecamethyloctatetracontane-1,2,3,7,11,15,19,23,27,31,35,39,43,47-tetradecol	present	LOTUS
(3S)-3-hydroxy-3-methyl-5-[(2R,3S,6E,10E,15S,19S,23S,27S,31S,35S)-2,3,15,19,23,27,31,35-octahydroxy-3,7,11,15,19,23,27,31,35,39-decamethyltetraconta-6,10,38-trienoxy]-5-oxopentanoic acid	present	LOTUS
(3S)-3-hydroxy-3-methyl-5-[(2R,3S,6E,10E,15S,19S,23S,27S,31S,35S,39S)-2,3,15,19,23,27,31,35,39-nonahydroxy-3,7,11,15,19,23,27,31,35,39,43-undecamethyltetratetraconta-6,10,42-trienoxy]-5-oxopentanoic acid	present	LOTUS
(3S)-5-[(2R,3S,6E,10E,15S,19S,23S,27S,31S)-2,3,15,19,23,27,31-heptahydroxy-3,7,11,15,19,23,27,31,35-nonamethylhexatriaconta-6,10,34-trienoxy]-3-hydroxy-3-methyl-5-oxopentanoic acid	present	LOTUS
(3S,8S)-deca-4,6-diyne-1,3,8-triol	present	LOTUS
(3S,9S,10R,13R,14R,17R)-17-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-3-hydroperoxy-10,13-dimethyl-2,3,4,9,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthrene	present	LOTUS
(E,2R,3R,11R,15R,19R,23R,27R,31S,35S,39S,43S)-3,7,11,15,19,23,27,31,35,39,43,47-dodecamethyloctatetracont-6-ene-1,2,3,11,15,19,23,27,31,35,39,43,47-tridecol	present	LOTUS
(E,2R,3R,11R,15R,19R,23R,27S,31S,35S)-3,7,11,15,19,23,27,31,35,39-decamethyltetracont-6-ene-1,2,3,11,15,19,23,27,31,35,39-undecol	present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phaeolepiota aurea has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes4

GenBank sequences9

eDNA detections35

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMW147713.1 ↗259 bp

ACGT

GGCTCTTAGGAGCATTGTGCACACCCCCAACTTTACTTCTCCACCTGTGCACCTTTTGTAGACTTGTTGAAAATCTCGGGTTTTCCAACT …

Phaeolepiota aurea voucher FRIr 1 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS928SEF1-alphaRPB2

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Phaeolepiota aurea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈34 055 498 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Phaeolepiota aurea0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type3 641 records

Wild obs. + sensor3 181

Museum / vouchered401

Cultivated / captive3

Other56

Origin

Introduced2

Range

Area of Occupancy AOO6 812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 619≤1 km 149≤10 km 1 951>10 km 5

2 724 georeferenced · 457 without coordinates

Open the mapobservation + sensor3 181

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 12≤1 km 59≤10 km 58>10 km 29

158 georeferenced · 243 without coordinates

Open the institutions mapphysical evidence401

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions33 of 57 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	25
WTUlocation not on record	22
Joensuu, FI	22
Copenhagen, DK	17
Chiba, JP	16
WU-MYClocation not on record	15
Karlsruhe, DE	12
Bando, JP	12
Vancouver, CA	11
Osaka, JP	11
BDBClocation not on record	10
GJOlocation not on record	10
Denver, US	9
Zürich, CH	8
Tomioka, JP	7
Kew, GB	7
Nagatoro-machi, Chichibu-gun, JP	7
Göteborg, SE	6
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	6
Philadelphia, US	6
Görlitz, DE	6
Pullman, US	6
Jyväskylä, FI	6
TENN-Flocation not on record	5
San Sebastián, ES	5
LDlocation not on record	5
Acadia Universitylocation not on record	5
MeiseBGlocation not on record	4
Tartu, EE	4
Universidade de Lisboa, Museu Bocagelocation not on record	4
Provincia di Livornolocation not on record	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
National Museum of Natural Sciencelocation not on record	3
Chicago, US	3
Tilburg, NL	3
Salzburg, AT	3
Vitoria, ES	3
Kyiv, UA	2
Mlocation not on record	2
Odawara, JP	2
University of Oslo, Natural History Museumlocation not on record	2
Champaign, US	2
IB FRC Komi SC UB RASlocation not on record	2
GZUlocation not on record	2
Royal Botanic Gardens, Kewlocation not on record	2
Berlin, DE	1
St. Paul, US	1
Staten Island, US	1
Tromso University Museumlocation not on record	1
Catholic University of Pekinglocation not on record	1
ILLSlocation not on record	1
Mexico City, MX	1
IPA/SPlocation not on record	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Gijón, ES	1
Bronx, US	1
DPIlocation not on record	1

57 institutions · 340 of 401 vouchered records shown · 59 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA35 detections

Where the DNA of Phaeolepiota aurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys4

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map5 countries0

Ring on lawn

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.90 °C 4.80–17.8

Seasonal swing summer↔winter22.7 °C

Max temp (day)9.10 °C 7.20–21.5

Min temp (night)4.70 °C 0.2–13.7

Precipitation74.5 mm/mo 32.5–90.0

Air humidity64.0 % 59.6–68.4

Moisture balance4.40 mm/mo -56.1–49.1

Vapour deficit401 Pa 285–811

Wind speed3.90 m/s 3.10–4.70

Cloud cover47.0 % 38.3–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources9 archives

Compound class profile5 classes

Documented compounds16 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 641 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions33 of 57 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 641 records