Phaeocollybia attenuata

(A.H.Sm.) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Phaeocollybia

At a glance

Occurrence records193

Data sources6

Biological traits0

DNA specimens6

eDNA detections6

Sources6 archives

Databases and archives Phaeocollybia attenuata's data was compiled from.

GBIFGlobal Biodiversity Information Facility193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF193 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phaeocollybia attenuata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ356775.1 ↗298 bpUSA · 1957

ACGT

GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAAAAAGAATCTTTGATAGTATTATCAA …

Phaeocollybia attenuata clone 4008 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type193 records

Wild obs. + sensor47

Museum / vouchered146

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 11≤1 km 8≤10 km 10>10 km 10

39 georeferenced · 8 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 1≤1 km 38≤10 km 87

126 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	122
Ann Arbor, US	10
California State University, East Baylocation not on record	3
Vancouver, CA	2
Santa Cruz, US	2
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1
TENN-Flocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
CA	1
ILLSlocation not on record	1
Research Collection of Joann Olsonlocation not on record	1

11 institutions · 145 of 146 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Phaeocollybia attenuata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Mile marker 2 on Davison Rd.Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 8.80–12.7

Seasonal swing summer↔winter5.20 °C

Max temp (day)13.2 °C 11.4–15.6

Min temp (night)9.10 °C 6.40–10.3

Precipitation258 mm/mo 145–326

Air humidity62.5 % 60.1–65.0

Moisture balance189 mm/mo 74.9–274

Vapour deficit488 Pa 447–527

Wind speed3.40 m/s 1.90–3.90

Cloud cover55.8 % 48.8–56.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)