Phacidiopycnis washingtonensis

C.L.Xiao & J.D.Rogers · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Phacidiales/Phacidiaceae/Phacidiopycnis

At a glance

Occurrence records32

Data sources6

Biological traits0

DNA specimens13

eDNA detections15

Sources6 archives

Databases and archives Phacidiopycnis washingtonensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility32 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF32 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD · NCBI13 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phacidiopycnis washingtonensis has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes1

GenBank sequences10

eDNA detections15

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ060171.1 ↗451 bpUSA · 2012

ACGT

CTTCGGGGTAGACCTCCCACCCTTTGTTTACAATACCATTGTTGCTTTGGCGGCCCCGTCGCAAGACAACCGGCTCCGGCTGGTCAGTGG …

Phacidiopycnis washingtonensis isolate Pw-3407 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type32 records

Wild obs. + sensor26

Museum / vouchered6

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 20≤1 km 2≤10 km 1

23 georeferenced · 3 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	3
Bernard Price Institute for Palaeontological Researchlocation not on record	1

2 institutions · 4 of 6 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Phacidiopycnis washingtonensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 8.30–8.30

Seasonal swing summer↔winter17.7 °C

Max temp (day)11.9 °C

Min temp (night)4.60 °C

Precipitation58.1 mm/mo

Air humidity64.0 %

Moisture balance-4.10 mm/mo

Vapour deficit449 Pa

Wind speed3.70 m/s

Cloud cover41.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)