Peziza ammophila

Durieu & Lév. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Pezizaceae/Peziza

At a glance

Occurrence records3 791

Data sources9

Biological traits0

DNA specimens5

eDNA detections6

Sources9 archives

Databases and archives Peziza ammophila's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 791 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.05 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 791 records

Environmental DNA2 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT53 Mbp

01Narrative

Het zandtulpje is een bekervormige schimmel in het geslacht Peziza. Het leeft saprotroof op organische bestanddelen en afgestorven helm op zandduinen en stranden. Naarmate het ouder wordt, komt het uit het zand en splitst het. Het groeit van de lente tot de winter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Peziza ammophila has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences8

eDNA detections6

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPP854535.1 ↗535 bpSouth Korea · 2021

ACGT

TTCGGGGACCAGCCCTCTGGCGTCGACTTAAAAAATCGATTTGCTGGGGAGTGCCGGTGGATAGCCATCAACCTAACAAAAAACTTTCTA …

Peziza ammophila voucher KA21-1197 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Peziza ammophila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size53 010 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Peziza ammophila0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type3 791 records

Wild obs. + sensor3 698

Museum / vouchered93

Origin

Native3

Range

Area of Occupancy AOO2 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤100 m 206≤1 km 219≤10 km 2 777>10 km 13

3 215 georeferenced · 483 without coordinates

Open the mapobservation + sensor3 698

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 2≤10 km 11>10 km 2

15 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence93

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	17
Kew, GB	8
Berlin, DE	6
Uppsala, SE	6
LDlocation not on record	5
Auckland, NZ	4
MeiseBGlocation not on record	4
WU-MYClocation not on record	3
DPIlocation not on record	3
Blacksburg, US	3
JA-CAGPDS-CAMlocation not on record	2
WTUlocation not on record	2
Philadelphia, US	2
Adam Mickiewicz University in Poznańlocation not on record	2
Parkville, AU	2
FLASlocation not on record	1
SLU Artdatabankenlocation not on record	1
Göteborg, SE	1
Görlitz, DE	1
Museo Entomologico de Leonlocation not on record	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1
CA	1
Warsaw, PL	1
MAlocation not on record	1

24 institutions · 78 of 93 vouchered records shown · 14 without an institution code

09Environmental DNA6 detections

Where the DNA of Peziza ammophila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 6.60–13.5

Seasonal swing summer↔winter15.1 °C

Max temp (day)12.8 °C 9.90–15.6

Min temp (night)6.60 °C 2.40–10.7

Precipitation97.3 mm/mo 71.0–124

Air humidity61.4 % 60.5–62.4

Moisture balance13.4 mm/mo -19.3–46.2

Vapour deficit533 Pa 392–673

Wind speed4.60 m/s 3.50–5.60

Cloud cover39.3 % 39.0–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Peziza ammophila

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type3 791 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 791 records