Petrophile canescens

A.Cunn. ex R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Petrophile

At a glance

Occurrence records1 567

Data sources6

Biological traits37

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Petrophile canescens's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 567 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF1 567 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Petrophile canescens, commonly known as conesticks, is a species of flowering plant in the family Proteaceae and is endemic to eastern Australia. It is an erect shrub with pinnately-divided leaves and oval heads of hairy, white to pale cream-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length3 mm

Leaf length40 mm

Leaf length max90 mm

Leaf length min50 mm

Leaf mass per area337 g/m2

Leaf size244 mm²

Petiole length3.5 cm

Plant height1.2 m

Plant height max1.2 m

Plant height min0.5 m

Seed length9.26 mm

Seed mass3.38 mg

⚠ sources differ — TRY: 3.38 mg · AusTraits: 3.12 mg · GIFT: 3.38 mg

Seed mass max3.5 mg

Seed mass min3.25 mg

Seed width8.11 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeself

Flowering timeynnnnnnnyyyy

Life formshrub

Life spanperennial

Pollination syndromeanimal

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeterete

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Petrophile canescens has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

matKAJ966805.1 ↗633 bp

ACGT

TTTTCAAAAGAGAATCAAAGATTCTTTTTGTTCCTATATAATTCCCATGTATATGAATGCGAATCCATATTCGTTTTTCTCCGTAAAAAA …

Petrophile canescens plastid partial matK gene for maturase K, specimen voucher Qiu 98018 (Z)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4

plant barcode

08Occurrence & distribution

Record type1 567 records

Wild obs. + sensor1 070

Museum / vouchered443

Cultivated / captive13

Fossil1

Other40

Origin

Native139

Range

Area of Occupancy AOO3 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 823≤1 km 78≤10 km 37>10 km 16

954 georeferenced · 116 without coordinates

Open the mapobservation + sensor1 070

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 77≤1 km 81≤10 km 131>10 km 55

344 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence443

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy90% within 1 km

≤100 m 8≤1 km 1≤10 km 1

10 georeferenced · 3 without coordinates

Open the mapnot free-living13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	138
Brisbane, AU	119
Armidale, AU	59
Canberra, AU	55
Museo Entomologico de Leonlocation not on record	42
Kew, GB	6
John T. Waterhouse Herbariumlocation not on record	3
Hobart, AU	3
Adelaide, AU	3
Wuzhou, CN	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Bronx, US	1
Kensington, AU	1
James Cook Townsvillelocation not on record	1
Auckland, NZ	1
La Trobe Universitylocation not on record	1
Batemans Bay, AU	1

17 institutions · 438 of 443 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Petrophile canescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Petrophile canescens

At a glance

Sources6 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

At a glance

Record type1 567 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 567 records