Petrophile biloba

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Petrophile

At a glance

Occurrence records307

Data sources7

Biological traits22

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Petrophile biloba's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility307 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF307 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Flower detail Petrophile biloba, commonly known as granite petrophile, is a species of flowering plant in the family Proteaceae and is endemic to southwestern Western Australia. It is a shrub with pinnately-divided leaves with sharply-pointed tips, and oval heads of hairy, mostly grey to pink flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Fruit length6 mm

Leaf length12.5 mm

Petiole length2 cm

Plant height2 m

⚠ sources differ — AusTraits: 2 m · TRY: 1.5 m

Plant height max2 m

Plant height min0.5 m

Life cycle & reproduction5

Flowering timennnnnyyyyynn

Life formshrub

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeovate rhomboidal

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Petrophile biloba has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLDQ875832.1 ↗1 352 bp

ACGT

AAAGCAAGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTG …

Petrophile biloba ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type307 records

Wild obs. + sensor200

Museum / vouchered105

Cultivated / captive2

Origin

Native6

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 121≤1 km 30≤10 km 8>10 km 3

162 georeferenced · 38 without coordinates

Open the mapobservation + sensor200

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 10≤1 km 8≤10 km 56>10 km 17

91 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence105

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	48
Museo Entomologico de Leonlocation not on record	17
Canberra, AU	11
Adelaide, AU	8
Brisbane, AU	7
Mount Annan, AU	6
BGPAlocation not on record	3
Kew, GB	1
Hobart, AU	1
LDlocation not on record	1
Auckland, NZ	1
Smithfield, AU	1

12 institutions · 105 of 105 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Petrophile biloba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)