Petrocosmea forrestii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Gesneriaceae/Petrocosmea

At a glance

Occurrence records3

Data sources5

Biological traits2

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Petrocosmea forrestii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 records

DNA & barcodingNCBIsequences

01Narrative

Petrocosmea forrestii is a species of flowering plant in the family Gesneriaceae native to China, and sometimes cultivated as a houseplant. It grows among rocks in shady places. Like other species in its genus, it does not develop a stem above ground, but spreads by rhizomes. The entire rosette of leaves is less than 15 cm in diameter.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formlithophyte

Habitat & environment1

Climatetemperate

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Petrocosmea forrestii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSKR006464.1 ↗679 bp

ACGT

ATCATTGTCGAGACCTGCAAAGCAGACCCGTGAACATGTTTAAATACGGCGTCGGCCATGTCGTATTCCTTTGTGTCTGACATCCCGATC …

Petrocosmea forrestii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type3 records

Museum / vouchered3

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	2
Kunming, CN	1

2 institutions · 3 of 3 vouchered records shown