Petrocallis pyrenaica

(L.) W.T.Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Petrocallis

At a glance

Occurrence records3 273

Data sources7

Biological traits25

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Petrocallis pyrenaica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 273 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF3 273 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

La Drave des Pyrénées ou Pétrocalle des Pyrénées est une espèce de plantes vivaces herbacée de montagne de la famille des Brassicacées et du genre Petrocallis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology7

Leaf size6.32 mm²

Plant height0.035 m

⚠ sources differ — GIFT: 0.035 m · LEDA: 0.035 m · TRY: 0.015 m

Plant height generative0.02 m

Plant height max0.08 m

Plant height min0.02 m

Seed length1.75 mm

Seed mass1.04 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering endJun

Flowering startMay

Life formsubshrub

Life spanperennial

Lifespan years8 years

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)329 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)14.71 mm²/mg

Other traits1

Diaspore typeseed

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Petrocallis pyrenaica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ497871.1 ↗582 bpAustria

ACGT

TCGATACCTAGAACAAAATGACCCGAGAACGCTCGATCATCACTCTCGGCGGGCCAGTTTCTTAGCCGATCTCGTTTTTGCTGATTCTGT …

Petrocallis pyrenaica internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Petrocallis pyrenaica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome records14–142n range14median14mode16records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1416×CCDB · slov-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +5

CCDB · slov-fl — Marhold K. & Valachovič M., 1990: Rozšírenie a ekológia druhu Petrocallis pyrenaica (L.) R. Br. v Belanských Tatrách. - Biologia (Bratislava) 45/5: 433-439.

CCDB · fl-europaea — Favarger, 1953

CCDB · ipcn-api-dl — Marhold, K. & M. Valachovič. 1990. Rožsírenie a ekológia druhu Petrocallis pyrenaica (L.) R. Br. v Belansk@3ych Tatrách. Biologia (Bratislava) 45: 433–439.

CCDB · ipcn-api-dl — Dobea, C. & B. Hahn. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 15–18.

CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.

CCDB · book-fedorov — Favarger 1953

CCDB · book-fedorov — D. 1955)

CCDB · brass — Dobes & Hahn

CCDB · brass — Kpfer

CCDB · brass — Marhold & Valachovic

CCDB · brass — Favarger

CCDB · book-atlas-flowering-plants — Favarger 1953

CCDB · CromoCat 2015 — Dobeš, C. & Hahn, B. (1997). IOPB Chromosome Data 11 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 26-27: 15-18.

CCDB · CromoCat 2015 — Marhold, K. & M. Valachovi? (1990). Rožsírenie a ekológia druhu Petrocallis pyrenaica (L.) R. Br. v Belansk@3ych Tatrách Biologia (Bratislava) 45: 433–439

CCDB · CromoCat 2015 — Stace, C. A. (1997). IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. 26/27: 13-26

08Occurrence & distribution

Record type3 273 records

Wild obs. + sensor3 195

Museum / vouchered64

Other14

Range

Area of Occupancy AOO2 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 900≤1 km 194≤10 km 854>10 km 345

2 293 georeferenced · 902 without coordinates

Open the mapobservation + sensor3 195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 1≤1 km 5≤10 km 5

11 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	31
Oskarshamn, SE	6
Provincia di Livornolocation not on record	5
Universidad del Pais Vasco (UPV/EHU)location not on record	2
BIO-UNIPIlocation not on record	2
Helsinki, FI	2
BClocation not on record	2
Sion, CH	1
Frankfurt am Main	1
Adam Mickiewicz University in Poznańlocation not on record	1

10 institutions · 53 of 64 vouchered records shown · 10 without an institution code

09Environmental DNA1 detections

Where the DNA of Petrocallis pyrenaica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.00 °C 7.00–7.00

Seasonal swing summer↔winter19.8 °C

Max temp (day)11.2 °C

Min temp (night)2.10 °C

Precipitation170 mm/mo

Air humidity64.0 %

Moisture balance100 mm/mo

Vapour deficit403 Pa

Wind speed2.60 m/s

Cloud cover44.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Petrocallis pyrenaica

At a glance

Sources7 archives

Size & morphology7

Life cycle & reproduction7

Diet & foraging1

Habitat & environment6

Physiology & chemistry3

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 273 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 273 records