Petrobium arboreum

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Petrobium

At a glance

Occurrence records16

Data sources7

Biological traits4

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Petrobium arboreum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Petrobium is a genus in the family Asteraceae.Brown, Robert. 1818. Transactions of the Linnean Society of London 12(1): 113-114 description in Latin, commentary in EnglishTropicos, Petrobium R. Br. The only known species is Petrobium arboreum, called Saint Helena whitewood. It is found in the tree-fern thicket at the top of the central ridge of island of Saint Helena in the South Atlantic Ocean. The plants are either female or hermaphrodite, i.e. the species is gynodioecious.Flann, C (ed) 2009+ Global Compositae Checklist

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass3.58 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment2

Growth formtree

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Petrobium arboreum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY429099.1 ↗628 bp

ACGT

CAAGGCACAACACGTCAGGGTCTTTGAAGAGTTTCACCCGCATGAACCGAACACACGACACGAGAAGACAGTCTTATCAACCACCACTAG …

Petrobium arboreum internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type16 records

Wild obs. + sensor2

Museum / vouchered14

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	13
Vancouver, CA	1

2 institutions · 14 of 14 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Petrobium arboreum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)