Petradoria pumila

(Nutt.) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Petradoria

At a glance

Occurrence records760

Data sources12

Biological traits11

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Petradoria pumila's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility760 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionNPASS9 compounds

Occurrence & distributionGBIF760 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Petradoria is a genus of North American subshrubs in the tribe Astereae within the family Asteraceae.Greene, Edward Lee. 1895. Erythea 3(1): 13 entirely in EnglishTropicos, Petradoria Greene Species The only known species is Petradoria pumila, known by the common name rock goldenrod. It is native to the western United States (California, Arizona, Nevada, Utah, New Mexico, Colorado, Wyoming, Idaho).Biota of North America Program 2013 county distribution map It is quite common in some regions, carpeting areas in yellow blooms.Flora of North America, Vol. 20 Page 171, Rock goldenrod, Petradoria Greene, Erythea. 3: 13. 1895.Flann, C (ed) 2009+ Global Compositae Checklist Formerly included Petradoria discoidea L.C.Anderson - Cuniculotinus gramineus (H.M.Hall) Urbatsch, R.P.Roberts & Neubig Subspecies Petradoria pumila subsp. pumila Petradoria pumila subsp. graminea (Wooton & Standl.) L.C.Anderson

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.19 mg

Seed mass max1.2 mg

Seed mass min1.18 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessnon-woody

03Chemical composition9 compounds

Compounds documented for Petradoria pumila across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Taxane diterpenoids $ Tetracyclic diterpenoids1

Arteminisin1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
Artemisinin	present	NPASS
BTUGXVXABNMDKY-VBSSCBDISA-N	present	NPASS
HZUKVQHPHZPOEM-PLVUCCGMSA-N	present	NPASS
Paclitaxel	present	NPASS
RREGFXUQGFWICS-QJXUJVHKSA-N	present	NPASS
TYXVTGSQLKCKCF-SFPOZDJVSA-N	present	NPASS
UOVUMXIDHMTOCT-UQJCPLMDSA-N	present	NPASS
VGTRRVYFVKZHFC-UHFFFAOYSA-N	present	NPASS
WZSACOQGPOAZIO-UZIWBGLDSA-N	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Petradoria pumila has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY170959.1 ↗567 bp

ACGT

TCGAAGCCTGCAAAGCTGAACGACCCGTGAACATGTTACAACAACCATGCCAGGATGGGTCGGACGTCAGTTTGATTCTCGTGGCACACC …

Petradoria pumila 7889 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Petradoria pumila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · book-ipcn66 · CCDB · book-ipcn67-71 · CCDB · eflora +1

CCDB · book-ipcn66 — Kapoor & Beaudry 1966

CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1969. Etudes sur les Solidago L. IX. Une liste de nombres chromosomiques des taxons du genre Solidago et de certains genres voisins. Naturaliste Canad. 96: 103-114.

CCDB · eflora

CCDB · book-fedorov — Anderson L. C. 19611:

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type760 records

Wild obs. + sensor448

Museum / vouchered312

Origin

Native12

Range

Area of Occupancy AOO2 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 286≤1 km 26≤10 km 18>10 km 27

357 georeferenced · 91 without coordinates

Open the mapobservation + sensor448

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 14≤1 km 50≤10 km 47>10 km 4

115 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence312

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	41
Flagstaff, US	35
Provo, US	29
Musee des Dinosaures d'Esperaza (Aude)location not on record	25
Riverside, US	18
Albuquerque, US	14
Logan, US	14
Phoenix, US	11
Boise, US	10
Moscow, US	10
Bronx, US	9
Durango, US	7
ASUlocation not on record	7
Denver, US	6
Bureau of Land Management, Caliente Field Officelocation not on record	6
University of Stellenboschlocation not on record	5
Orem, US	5
Tempe, US	5
Eastern Nevada Landscape Coalitionlocation not on record	5
Grand Junction, US	5
Angwin, US	4
Chongqing Museumlocation not on record	4
Bureau of Land Managementlocation not on record	4
Claremont, US	3
US	3
Saint Louis, US	2
Rocky Mountain Biological Laboratorylocation not on record	2
San Luis Obispo, US	2
Henderson, US	2
Pocatello, US	2
Pullman, US	1
Pittsburg, US	1
Mississippi State, US	1
Weber State Universitylocation not on record	1
Los Angeles, US	1
US	1
Bandelier National Monumentlocation not on record	1
BAYLUlocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
AUAlocation not on record	1
Calvin Collegelocation not on record	1
Jackson, US	1
Lincoln, US	1
WTUlocation not on record	1
Bloomington, US	1
University of Alberta Museumslocation not on record	1

47 institutions · 312 of 312 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Petradoria pumila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)