Petasites spurius

(Retz.) Rchb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Petasites

At a glance

Occurrence records6 274

Data sources8

Biological traits28

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Petasites spurius's data was compiled from.

GBIFGlobal Biodiversity Information Facility6 274 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources28 traits

Chemical compositionNPASS12 compounds

Occurrence & distributionGBIF6 274 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 60

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Leaf mass5 430 mg

Leaf size59 256 mm²

Plant height0.2 m

Plant height generative0.2 m

Plant height max0.7 m

Life cycle & reproduction11

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typeanimal

Flowering endMay

Flowering startMay

Life formrhizomatous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Seed number3 606

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, lakes, rivers, sand, steppe

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)170 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)10.66 mm²/mg

Other traits1

Diaspore typefruit with appendage

03Chemical composition12 compounds

Compounds documented for Petasites spurius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Abeoabietane diterpenoids2

Lupane triterpenoids2

Secoabietane diterpenoids2

Abietane diterpenoids2

Abietane diterpenoids $ Podocarpane diterpenoids2

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4aR,6aR,6bS,8aR,14aR,14bR)-4,4,6a,6b,8a,11,11,14b-octamethyl-1,2,3,4a,5,6,7,8,9,10,12,13,14,14a-tetradecahydropicene-2,3-diol	present	NPASS
(4aS,10aS)-6-hydroxy-1,1,4a-trimethyl-7-propan-2-yl-3,9,10,10a-tetrahydro-2H-phenanthren-4-one	present	NPASS
(4bS,8aS,9R,10R)-3-methoxy-4b,8,8-trimethyl-2-propan-2-yl-5,6,7,8a,9,10-hexahydrophenanthrene-4,9,10-triol	present	NPASS
Aethiopinone	present	NPASS
Lup-20(29)-ene-2alpha,3beta-diol	present	NPASS
Lupeol	present	NPASS
Microstegiol	present	NPASS
OVPNXMAUIWWJFL-FKZBLDDMSA-N	present	NPASS
Sugiol	present	NPASS
trans-Ferruginol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Petasites spurius has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKU570798.1 ↗636 bp

ACGT

CTGCATAGCAAAACGACCCGTGAACATGTTACAACAACAATCTGGTGTCCTTAGTGTCGGGCTATTATTTGATTCTTTGGATGCCTTGTC …

Petasites spurius isolate AST26 internal transcribed spacer 1, partial sequence; and 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Petasites spurius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome records60–602n range60median60mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 606×CCDB · fl-europaea · CCDB · book-northern-plants · CCDB · book-fedorov +1

CCDB · fl-europaea — S^rensen &

CCDB · book-northern-plants — Langlet 1936.

CCDB · book-fedorov — Langlet 1936

CCDB · book-fedorov — Sorensen,. Christiansen 1964

CCDB · book-fedorov — Langlet (T. 1938)

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 274 records

Wild obs. + sensor5 164

Museum / vouchered1 099

Cultivated / captive9

Other2

Origin

Introduced1

Range

Area of Occupancy AOO12 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 2 590≤1 km 610≤10 km 709>10 km 243

4 152 georeferenced · 1 012 without coordinates

Open the mapobservation + sensor5 164

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 12≤1 km 59≤10 km 393>10 km 87

551 georeferenced · 548 without coordinates

Open the institutions mapphysical evidence1 099

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 6

7 georeferenced · 2 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	186
LDlocation not on record	165
Uniwersytet Wrocławskilocation not on record	143
Berlin, DE	90
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	77
Tartu, EE	70
Oskarshamn, SE	45
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	28
Adam Mickiewicz University in Poznańlocation not on record	22
Philadelphia, US	20
Uniwersytet Warszawskilocation not on record	14
Görlitz, DE	14
Tallinn, EE	11
SLU Artdatabankenlocation not on record	10
Uppsala, SE	9
Karlsruhe, DE	7
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	4
NMBU:MINAlocation not on record	2
Prioksko-Terrasnyi Biosphere Reservelocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Dresden, DE	2
DBF-NHMDlocation not on record	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Trondheim, NO	2
Stockholm, SE	2
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	2
Zürich, CH	1
Wlocation not on record	1
University of Stellenboschlocation not on record	1
UoB-IBlocation not on record	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Turku, FI	1
Dekalb, US	1
Xiamen, CN	1
Oulu, FI	1

35 institutions · 942 of 1 099 vouchered records shown · 108 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Petasites spurius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Petasites spurius

At a glance

Sources8 archives

Size & morphology5

Life cycle & reproduction11

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

Other traits1

Compound class profile5 classes

Documented compounds12 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 274 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type6 274 records