Petasites pyrenaicus

(L.) G.López · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Petasites

At a glance

Occurrence records41 406

Data sources12

Biological traits46

DNA specimens6

eDNA detections4

Sources12 archives

Databases and archives Petasites pyrenaicus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 406 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources46 traits

Chemical compositionLOTUS12 compounds

Occurrence & distributionGBIF41 406 records

Environmental DNA1 datasets · 3 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 60

01Narrative

Petasites pyrenaicus, the winter heliotrope, is a medicinal and ornamental flowering plant in the family Asteraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTAusTraitsWCVP

Size & morphology20

Fruit length1.75 mm

Leaf length55 mm

Leaf length max160 mm

Leaf mass146 mg

Leaf size31 623 mm²

⚠ sources differ — TRY: 31 623 mm² · LEDA: 4 218 mm² · GIFT: 4 218 mm²

Leaf width125 mm

Leaf width max120 mm

Leaf width min120 mm

Petiole length20 cm

Plant height0.25 m

⚠ sources differ — GIFT: 0.25 m · AusTraits: 0.4 m · TRY: 0.175 m

Plant height max0.5 m

Seed length0 mm

Seed length max0 mm

Seed length min0 mm

Seed mass0.1 mg

Seed mass max0 mg

Seed mass min0 mg

Seed width0 mm

Seed width max0 mm

Seed width min0 mm

Life cycle & reproduction10

Deciduousnesssemi-evergreen

⚠ sources differ — TRY: semi-evergreen · GIFT: variable

Dispersal typehuman

⚠ sources differ — LEDA: ethelochor · GIFT: unspecialized

Life formrhizomatous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualpresent

Self fertilizationabsent

Sex typedioecious

⚠ sources differ — AusTraits: dioecious · GIFT: bisexual

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typeachene

Growth formherb

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapeorbicular reniform

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)158 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)28.81 mm²/mg

⚠ sources differ — TRY: 28.81 mm²/mg · LEDA: 24.05 mm²/mg · GIFT: 24.05 mm²/mg

Other traits1

Seeds per fruit0

03Chemical composition12 compounds

Compounds documented for Petasites pyrenaicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Eremophilane sesquiterpenoids7

Pyrrolizidine alkaloids3

Cinnamic acids and derivatives1

Indolizidine alkaloids $ Pyrrolizidine alkaloids1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Petasin	present	LOTUS
(1R,4Z,6S,7R,11Z)-4-ethylidene-7-hydroxy-6,7,14-trimethyl-2,9-dioxa-14-azabicyclo[9.5.1]heptadec-11-ene-3,8,17-trione	present	LOTUS
7-Angelylretronecine	present	LOTUS
Isopetasin	present	LOTUS
Isopetasol	present	LOTUS
Methyl Caffeate	present	LOTUS
Neopetasol	present	LOTUS
Petasinine	present	LOTUS
Petasol	present	LOTUS
S-Neopetasin	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Petasites pyrenaicus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences3

eDNA detections4

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPZ361600.1 ↗433 bpUnited Kingdom · 2021

ACGT

ACTCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCACCACA …

Petasites pyrenaicus voucher EDNA21-0060648 internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Petasites pyrenaicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome records52–602n range60median60mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 606×CCDB · iber-fl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.

CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I

CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.

CCDB · CromoCat 2015 — Queirós, M. (1973b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. II. Compositae, supl. 1. Bol. Soc. Brot. 47: 299-314.

2n 524×CCDB · brit-fl · CCDB · iber-fl · CCDB · book-fedorov +1

CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · book-fedorov — Maude 1939, 1940

CCDB · book-atlas-flowering-plants — Maude 1940

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type41 406 records

Wild obs. + sensor41 083

Museum / vouchered222

Other101

Origin

Native58

Introduced4 732

Range

Area of Occupancy AOO52 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 11 396≤1 km 6 647≤10 km 19 368>10 km 160

37 571 georeferenced · 3 512 without coordinates

Open the mapobservation + sensor41 083

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 4≤1 km 39≤10 km 22>10 km 2

67 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence222

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	76
BIO-UNIPIlocation not on record	46
Hobart, AU	12
Museo Entomologico de Leonlocation not on record	11
BClocation not on record	10
MAlocation not on record	5
DASSHlocation not on record	4
Bern, CH	4
Görlitz, DE	3
Canberra, AU	2
Rotorua, NZ	2
South Kensington, GB	2
Wellington, NZ	2
LDlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
València, ES	2
Lausanne, CH	2
Canadian Department of Agriculturelocation not on record	2
Granada, ES	2
Mlocation not on record	2
Gijón, ES	1
Museo Achille Folettolocation not on record	1
Québec, CA	1
Alicante, ES	1
Bourges, FR	1
Phyletisches Museum Jenalocation not on record	1
Salamanca, ES	1
CICYTEXlocation not on record	1
DBF-NHMDlocation not on record	1
MeiseBGlocation not on record	1
Brisbane, AU	1
Henry Brockhouse Collectionlocation not on record	1
Muséum Henri Lecoqlocation not on record	1
San Sebastián, ES	1
Mount Annan, AU	1
CJBGlocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
Palmerston North, NZ	1
Entomological Society of Latvialocation not on record	1

39 institutions · 212 of 222 vouchered records shown · 8 without an institution code

09Environmental DNA4 detections

Where the DNA of Petasites pyrenaicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

Roadside in forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.00 °C 6.00–13.7

Seasonal swing summer↔winter12.7 °C

Max temp (day)10.2 °C 9.40–18.4

Min temp (night)3.40 °C 1.80–9.00

Precipitation70.4 mm/mo 51.8–118

Air humidity62.6 % 58.7–62.9

Moisture balance-0.3 mm/mo -22.5–43.4

Vapour deficit372 Pa 360–717

Wind speed3.00 m/s 2.90–5.30

Cloud cover41.2 % 39.4–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Petasites pyrenaicus

At a glance

Sources12 archives

Size & morphology20

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

Compound class profile4 classes

Documented compounds12 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type41 406 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type41 406 records