Persoonia daphnoides

A.Cunn. ex R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Persoonia

At a glance

Occurrence records66

Data sources6

Biological traits23

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Persoonia daphnoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility66 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF66 records

DNA & barcodingNCBIsequences

01Narrative

Persoonia daphnoides is a plant in the family Proteaceae and is endemic to a restricted area in eastern Australia. It is a prostrate shrub with spatula-shaped to egg-shaped leaves with the narrower end towards the base, and yellow flowers in groups of up to eight on a rachis up to long.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length32.5 mm

Leaf length max50 mm

Leaf length min15 mm

Leaf width12 mm

Leaf width max20 mm

Leaf width min4 mm

Plant height0.1 m

Life cycle & reproduction4

Flowering timeynnnnnnnnnny

Life formsubshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapeobovate spathulate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Persoonia daphnoides has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX669320.1 ↗577 bpAustralia

ACGT

CCCGCGAACATGTTGCACCTTGAGCAGGGGTTGGGGCTTTTGGGACGTGAGTCCCTTCGTCATCGGCCCCTACAGTCTGTGTCCACGATT …

Persoonia daphnoides isolate Pdaph_NSW565583 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type66 records

Wild obs. + sensor31

Museum / vouchered35

Origin

Native13

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 31

31 georeferenced

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 4≤1 km 4≤10 km 11>10 km 1

20 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	13
Brisbane, AU	8
Armidale, AU	5
Canberra, AU	5
Museo Entomologico de Leonlocation not on record	1
Kew, GB	1
Adelaide, AU	1

7 institutions · 34 of 35 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)