Peroneutypa scoparia

(Schwein.) Carmarán & A.I.Romero · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Xylariales/Diatrypaceae/Peroneutypa

At a glance

Occurrence records639

Data sources10

Biological traits0

DNA specimens33

eDNA detections46

Sources10 archives

Databases and archives Peroneutypa scoparia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility639 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS62 compounds

Occurrence & distributionGBIF639 records

Environmental DNA4 datasets · 15 countries46 detections

DNA & barcodingBOLD · NCBI33 specimens

Genome at a glanceGoaT · NCBI≈47 Mbp

01Narrative

Eutypella scoparia is a plant pathogen that causes Eutypa dieback on pecan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition62 compounds

Compounds documented for Peroneutypa scoparia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pimarane and Isopimarane diterpenoids15

Cytochalasan alkaloids8

Eudesmane sesquiterpenoids7

Simple aromatic polyketides5

Isocoumarins4

Documented compounds62 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3S,5R,6S,9S,10R)-5-ethenyl-3,6,9,10-tetrahydroxy-5,11,11-trimethyl-16-oxatetracyclo[7.5.2.01,10.02,7]hexadec-2(7)-en-8-one	present	LOTUS
(1R,5E,7R,9S,11E,13S,14S,17S,18S)-7,14-dihydroxy-18-[(4-methoxyphenyl)methyl]-7,9,15,16-tetramethyl-2,4-dioxa-19-azatricyclo[11.7.0.01,17]icosa-5,11,15-triene-3,8,20-trione	present	LOTUS
(1R,5E,7S,9R,11E,13R,14R,15S,16R,17R,18R)-7,14,15-trihydroxy-18-[(4-methoxyphenyl)methyl]-7,9,15,16-tetramethyl-2,4-dioxa-19-azatricyclo[11.7.0.01,17]icosa-5,11-diene-3,8,20-trione	present	LOTUS
(1S,2R,3R,5R,8R,9R,10R)-5-ethenyl-5,11,11-trimethyl-16-oxatetracyclo[7.5.2.01,10.02,7]hexadec-6-ene-2,3,8,9,10-pentol	present	LOTUS
(1S,2R,4S)-2-[(3S)-3-hydroxy-3-methylpent-4-enyl]-1,3,3-trimethylcyclohexane-1,4-diol	present	LOTUS
(1S,2S,3R,5R,9R,10R)-5-ethenyl-2,3,9,10-tetrahydroxy-5,11,11-trimethyl-16-oxatetracyclo[7.5.2.01,10.02,7]hexadec-6-en-8-one	present	LOTUS
(1S,2S,5R,9S,10R)-5-ethenyl-2,9,10-trihydroxy-5,11,11-trimethyl-16-oxatetracyclo[7.5.2.01,10.02,7]hexadec-6-en-8-one	present	LOTUS
(1S,4S)-1-[(2R,5R)-5-(2-hydroxypropan-2-yl)-2-methyloxolan-2-yl]-4-methylhex-5-ene-1,4-diol	present	LOTUS
(1S,4S,5S,9R)-8-(hydroxymethyl)-4-[(2R)-1-hydroxypropan-2-yl]-1-methylspiro[4.5]dec-7-en-9-ol	present	LOTUS
(1S,5Z,7R,9S,11E,13S,14S,16R,17S,18R,19S)-7-hydroxy-19-[(4-methoxyphenyl)methyl]-7,9,16,17-tetramethyl-2,4,15-trioxa-20-azatetracyclo[11.8.0.01,18.014,16]henicosa-5,11-diene-3,8,21-trione	present	LOTUS

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Peroneutypa scoparia has left across the world's sequence archives.

At a glance

DNA specimens33

Marker genes3

GenBank sequences10

eDNA detections46

Countries15

The DNA barcodea real sequence read deposited for this species

ITSPZ052361.1 ↗257 bpUSA · 2023

ACGT

AACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCTATTTGCTTGGCGTTGGGAGA …

Peroneutypa scoparia voucher Kauai_249 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS2

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Peroneutypa scoparia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈47 265 203 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Peroneutypa scoparia0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type639 records

Wild obs. + sensor457

Museum / vouchered178

Cultivated / captive3

Other1

Range

Area of Occupancy AOO1 692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 172≤1 km 43≤10 km 141>10 km 10

366 georeferenced · 91 without coordinates

Open the mapobservation + sensor457

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 7≤1 km 10≤10 km 18

35 georeferenced · 143 without coordinates

Open the institutions mapphysical evidence178

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	28
WU-MYClocation not on record	14
DPIlocation not on record	6
Natural History Museum Rotterdamlocation not on record	4
Kew, GB	4
Auckland, NZ	4
Toronto, CA	3
Staten Island, US	3
Görlitz, DE	3
Olocation not on record	2
San Sebastián, ES	2
nsnflocation not on record	2
Parkville, AU	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
SLU Artdatabankenlocation not on record	1
Zürich, CH	1
Gijón, ES	1
Museo Entomologico de Leonlocation not on record	1
Tilburg, NL	1
Vitoria, ES	1
GJOlocation not on record	1
BDBClocation not on record	1
ILLSlocation not on record	1
Copenhagen, DK	1
TROMlocation not on record	1

26 institutions · 89 of 178 vouchered records shown · 86 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA46 detections

Where the DNA of Peroneutypa scoparia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys4

Countries15

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map15 countries0

AfrotropicNeotropicmicrobial matIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.51 4.79–5.72

Conductivity32.8 µS/cm 28.8–48.2

Organic carbon0.018 % 0.004–0.023

Water content13.5 % 10.7–14.7

Nitrate-N1.78 mg/kg 0.644–6.93

Clay18.9 % 13.5–19.9

Sand65.1 % 64.1–71.1

Depth0 m

SoilKurosolChromosol

3 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 19.0–26.4

Seasonal swing summer↔winter3.30 °C

Max temp (day)26.9 °C 24.0–28.1

Min temp (night)18.1 °C 14.4–24.2

Precipitation134 mm/mo 93.2–250

Air humidity62.6 % 57.6–71.9

Moisture balance7.90 mm/mo -46.9–155

Vapour deficit1,018 Pa 722–1,241

Wind speed1.80 m/s 1.30–4.40

Cloud cover26.0 % 21.5–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)