Perittia obscurepunctella

Stainton, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Elachistidae/Perittia

At a glance

Occurrence records337

Data sources7

Biological traits2

DNA specimens8

eDNA detections12

Sources7 archives

Databases and archives Perittia obscurepunctella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility337 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF337 records

Environmental DNA3 datasets · 4 countries12 detections

DNA & barcodingBOLD8 specimens

01Narrative

Perittia obscurepunctella is a moth of the family Elachistidae found in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Perittia obscurepunctella has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections12

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATTTTTGGTATTTGAGCAGGGATAGTAGGAACATCTTTAAGTTTATTAATTCGTGCTGAATTAGGAAATCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Perittia cygnodiellasame genus5.8%Nola analissame order8.6%Eutelia furcatasame order9.1%Perittia echiellasame genus9.3%Nola sphaerospilasame order9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type337 records

Wild obs. + sensor236

Museum / vouchered101

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 67≤1 km 57≤10 km 104>10 km 3

231 georeferenced · 5 without coordinates

Open the mapobservation + sensor236

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 14≤1 km 3≤10 km 18>10 km 1

36 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	60
DanishLepidopterologicalSocietylocation not on record	17
SLU Artdatabankenlocation not on record	6
Helsinki, FI	5
Oulu, FI	3
Tartu, EE	2
Uniwersytet Łódzkilocation not on record	2
Metsähallituslocation not on record	1
South Kensington, GB	1

9 institutions · 97 of 101 vouchered records shown · 4 without an institution code

09Environmental DNA12 detections

Where the DNA of Perittia obscurepunctella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys3

Countries4

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 5.60–15.7

Seasonal swing summer↔winter17.1 °C

Max temp (day)13.0 °C 8.60–19.8

Min temp (night)4.60 °C 2.30–11.0

Precipitation48.7 mm/mo 33.1–76.0

Air humidity60.1 % 56.9–63.0

Moisture balance-36.0 mm/mo -54.1–-11.7

Vapour deficit467 Pa 355–710

Wind speed3.60 m/s 3.00–4.20

Cloud cover42.9 % 39.0–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)