Perittia herrichiella

(Herrich-Schäffer, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Elachistidae/Perittia

At a glance

Occurrence records506

Data sources7

Biological traits0

DNA specimens49

eDNA detections46

Sources7 archives

Databases and archives Perittia herrichiella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility506 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF506 records

Environmental DNA2 datasets · 7 countries46 detections

DNA & barcodingBOLD49 specimens

01Narrative

Perittia herrichiella is a moth of the family Elachistidae. It is found from Sweden and Finland to the Pyrenees and Italy and from France to the Baltic region and Romania.Fauna Europaea It has also been recorded from RussiaKaila, L., Nupponen, K., Junnilainen, J., Nupponen, T., Kaitila, J.-P. & Olschwang, V. 2003: Contribution to the fauna of Elachistidae (Lepidoptera) of the Southern Ural Mountains. - Entomol. Fennica 14: 65–90. and North America, including New York, Ontario,Bug Guide Indiana and Michigan. The expected range of the species is south-eastern Canada and the north-central and north-eastern parts of the United States.microleps.org The wingspan is 8–9 mm. Adults are on wing from May to August.Swedish Moths The larvae feed on Lonicera alpigena, Lonicera periclymenum, Lonicera tatarica, Lonicera xylosteum and Symphoricarpos albus. They mine the leaves of their host plant. The mine starts as a short corridor. Which is followed (and often overrun) by a large flat blotch that expands towards the leaf margin. The frass is deposited in scattered blackish lumps.bladmineerders.nl Larvae can be found from June to mid August or October depending on the location.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Perittia herrichiella has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes1

eDNA detections46

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

317Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAACTAGGGAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes8

BIN1

Most divergent pair0.46%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nola politzarisame order9.7%Nola afrotaeniatasame order9.7%Nola analissame order9.8%Ochrothripa leptochromasame order9.9%Glyphodes caesalissame order9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type506 records

Wild obs. + sensor353

Museum / vouchered133

Other20

Range

Area of Occupancy AOO1 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 164≤1 km 94≤10 km 43>10 km 18

319 georeferenced · 34 without coordinates

Open the mapobservation + sensor353

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 19≤1 km 33≤10 km 15

67 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	18
Cornell University Insect Collectionlocation not on record	16
SLU Artdatabankenlocation not on record	15
Stockholm, SE	13
Tartu, EE	11
Helsinki, FI	9
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
East Lansing, US	5
Research Collection of Peter Lichtmanneckerlocation not on record	4
DanishLepidopterologicalSocietylocation not on record	3
Oulu, FI	2
Research Collection of Daniel Handfieldlocation not on record	2
Biodiversity Institute of Ontariolocation not on record	1
Research Collection of Richard Heindellocation not on record	1

15 institutions · 115 of 133 vouchered records shown · 18 without an institution code

09Environmental DNA46 detections

Where the DNA of Perittia herrichiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys2

Countries7

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map7 countries0

ForestRiparian ZonefarmMixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.3 °C 6.50–19.0

Seasonal swing summer↔winter25.5 °C

Max temp (day)20.5 °C 11.6–23.8

Min temp (night)11.5 °C 2.30–14.2

Precipitation84.7 mm/mo 63.3–118

Air humidity58.7 % 57.7–61.8

Moisture balance-36.9 mm/mo -57.7–9.70

Vapour deficit767 Pa 473–919

Wind speed2.90 m/s 2.00–3.80

Cloud cover41.1 % 34.8–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)