Peritropha oligodrachma

Diakonoff, 1954 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Peritropha

At a glance

Occurrence records155

Data sources7

Biological traits0

DNA specimens39

eDNA detections39

Sources7 archives

Databases and archives Peritropha oligodrachma's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility155 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF155 records

Environmental DNA1 datasets · 1 countries39 detections

DNA & barcodingBOLD39 specimens

01Narrative

Peritropha oligodrachma is a species of moth of the family Oecophoridae. It is found in most of Australia. The wingspan is about 20 mm. The larvae live in a tunnel on the underside of a leaf of its food plant. It feeds on the leaves of various Eucalyptus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Peritropha oligodrachma has left across the world's sequence archives.

At a glance

DNA specimens39

BINs1

Marker genes2

eDNA detections39

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

223Amostly conserved

391Tmostly conserved

514Cmostly conserved

613Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCATTAAGTTTATTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes7

BIN1

Most divergent pair0.76%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hypertropha desumptanasame family6.7%Hypertropha thesaurellasame family7.0%Gonionota dryodesmasame family7.1%Hypertropha chlaenotasame family7.3%Eupselia anommatasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type155 records

Wild obs. + sensor121

Museum / vouchered34

Range

Area of Occupancy AOO292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 56≤1 km 17≤10 km 4>10 km 1

78 georeferenced · 43 without coordinates

Open the mapobservation + sensor121

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	2
Australian National Insect Collectionlocation not on record	1
Sydney, AU	1
Tallinn, EE	1
Research Collection of Donald Hobernlocation not on record	1

5 institutions · 6 of 34 vouchered records shown · 28 without an institution code

09Environmental DNA39 detections

Where the DNA of Peritropha oligodrachma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 16.2–25.5

Seasonal swing summer↔winter10.3 °C

Max temp (day)24.3 °C 20.7–29.5

Min temp (night)15.4 °C 10.9–21.2

Precipitation78.2 mm/mo 5.90–127

Air humidity59.4 % 53.2–63.2

Moisture balance-60.9 mm/mo -135–29.8

Vapour deficit1,017 Pa 743–1,251

Wind speed2.60 m/s 1.70–4.10

Cloud cover27.4 % 19.9–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)