Peristernia nassatula

(Lamarck, 1822) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Neogastropoda/Fasciolariidae/Peristernia

At a glance

Occurrence records1 372

Data sources9

Biological traits2

DNA specimens7

eDNA detections1

Sources9 archives

Databases and archives Peristernia nassatula's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility884 records↗

OBISOcean Biodiversity Information System488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 372 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

Peristernia nassatula is a species of sea snail, a marine gastropod mollusk in the family Fasciolariidae, the spindle snails, the tulip snails and their allies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Peristernia nassatula has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes2

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.8%

Haplotypes2

BINs2

Most divergent pair0.46%

Where individuals differ — all 23 variable positions, in barcode order

40Avariable

61Tmostly conserved

82Gmostly conserved

110Tmostly conserved

169Cmostly conserved

184Cmostly conserved

208Amostly conserved

214Gmostly conserved

229Amostly conserved

232Tmostly conserved

256Tmostly conserved

262Gmostly conserved

281Cmostly conserved

298Gmostly conserved

352Amostly conserved

382Amostly conserved

406Cmostly conserved

442Tmostly conserved

490Avariable

500Cmostly conserved

508Tmostly conserved

619Gmostly conserved

634Cmostly conserved

GACATTATATATTTTGTTTGGAATATGATCGGGCTTAGTAGGTACTGCTTTAAGACTTCTTATTCGAGCTGAATTAGGGCAGCCTGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Peristernia reincarnatasame genus8.7%Leucozonia nassasame family13.4%Marmorofusus nicobaricussame family14.5%Aeneator valedictussame order14.8%Burnupena papyraceasame order15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type1 372 records

Wild obs. + sensor80

Museum / vouchered1 286

Cultivated / captive1

Other5

Range

Area of Occupancy AOO2 696 km²

Depth

0–200 m sunlit42

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.5 m · max 39 m · 42 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 16≤1 km 11≤10 km 5>10 km 12

44 georeferenced · 36 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 20≤1 km 236≤10 km 97>10 km 86

439 georeferenced · 847 without coordinates

Open the institutions mapphysical evidence1 286

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	161
Philadelphia, US	119
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	119
Paris, FR	104
Cambridge, US	67
Washington, US	39
Western Australian Museumlocation not on record	35
Los Angeles, US	32
Santa Barbara Museum of Natural Historylocation not on record	29
USPac-SMSlocation not on record	18
Natick, US	15
Brussels, BE	11
Natural History Museum Rotterdamlocation not on record	11
Denver, US	8
Museums Victorialocation not on record	7
Museum and Art Gallery of the Northern Territorylocation not on record	6
RBINS-Scientific Heritagelocation not on record	6
CASlocation not on record	5
University of Floridalocation not on record	4
Salzburg, AT	3
Paleontological Research Institutionlocation not on record	2
Auckland, NZ	2
Chongqing Museumlocation not on record	2
ELMClocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Delaware Museum of Nature and Sciencelocation not on record	2
Museu Nacional de História Natural e da Ciêncialocation not on record	2
Wakayama Prefectural Museum of Natural Historylocation not on record	1
Helsinki, FI	1
Gifu prefectural Museumlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Champaign, US	1
Toronto, CA	1
Yokosuka City Museumlocation not on record	1
Parthenon Tama History Museumlocation not on record	1
Chicago, US	1
Tomioka, JP	1
Royal Museum for Central Africalocation not on record	1
Stockholm, SE	1
QVMAGlocation not on record	1

40 institutions · 826 of 1 286 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Peristernia nassatula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Peristernia nassatula

At a glance

Sources9 archives

Habitat & environment2

At a glance

Record type1 372 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 372 records