Peristedion greyae

Miller, 1967 · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Peristediidae/Peristedion

At a glance

Occurrence records1 124

Data sources9

Biological traits6

DNA specimens7

eDNA detections0

Sources9 archives

Databases and archives Peristedion greyae's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility544 records↗

OBISOcean Biodiversity Information System580 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 124 records

DNA & barcodingBOLD7 specimens

01Narrative

Peristedion greyae, the alligator searobin, alligator armored searobin or prickly armoured sea robin, is a species of marine ray-finned fish belonging to the family Peristediidae, the armoured gurnards or armored sea robins. It is found in the western central Atlantic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length23.9 cm

Body mass68.4 g

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max165 m

Vulnerability13.9

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Peristedion greyae has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

337Tmostly conserved

349Cmostly conserved

412Tmostly conserved

593Cvariable

646Amostly conserved

CCTTTATCTAGTATTCGGTGCCTGAGCTGGGATAGTAGGCACAGCTTTAAGCCTTTTAATCCGAGCAGAACTAAGCCAACCGGGAGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Peristedion barbigersame genus6.3%Peristedion miniatumsame genus8.0%Peristedion weberisame genus9.7%Peristedion gracilesame genus9.8%Peristedion liorhynchussame genus9.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 124 records

Wild obs. + sensor17

Museum / vouchered1 104

Other3

Origin

Native41

Range

Area of Occupancy AOO2 060 km²

Depth

0–200 m sunlit5

200–1000 m twilight38

1–4 km midnight0

>4 km abyssal0

median 512.1 m · max 600 m · 43 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 32≤1 km 27≤10 km 27>10 km 44

130 georeferenced · 974 without coordinates

Open the institutions mapphysical evidence1 104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	291
Washington, US	62
University of Texas Biodiversity Collections (UTBC)location not on record	51
Texas Cooperative Wildlife Collectionlocation not on record	37
Chicago, US	18
Cambridge, US	17
CASlocation not on record	14
North Carolina Museum of Natural Scienceslocation not on record	12
FishBaselocation not on record	9
Montgomery, US	6
New Haven, US	5
University of Alabamalocation not on record	3
Paris, FR	2
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	2
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	2
South Kensington, GB	2
College Station, US	1
Mexico City, MX	1
UWFClocation not on record	1
Ann Arbor, US	1

20 institutions · 537 of 1 104 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Peristedion greyae

At a glance

Sources9 archives

Size & morphology2

Habitat & environment2

Other traits2

At a glance

Record type1 124 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 20 geolocated

Record type1 124 records