Peregrinus maidis

(Ashmead, 1890) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Delphacidae/Peregrinus

At a glance

Occurrence records331

Data sources9

Biological traits0

DNA specimens269

eDNA detections31

Sources9 archives

Databases and archives Peregrinus maidis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility331 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics269 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF331 records

Environmental DNA2 datasets · 6 countries31 detections

DNA & barcodingBOLD269 specimens

Genome at a glanceGoaT · NCBI≈653 Mbp

01Narrative

Peregrinus maidis, commonly known as the corn planthopper, is a species of insect in the order Hemiptera and the family Delphacidae. It is widespread throughout most tropical and subtropical regions on earth, including southern North America, South America, Africa, Australia, Southeast Asia and China. P. maidis are a commercially important pest of maize and its relatives. In addition to physical plant damage, P. maidis is the vector for several species-specific maize viruses, including maize stripe virus, maize mosaic virus and the non-pathogenic Peregrinus maidis reovirus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding269 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Peregrinus maidis has left across the world's sequence archives.

At a glance

DNA specimens269

BINs3

Marker genes2

eDNA detections31

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus266 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

67Cmostly conserved

85Avariable

163Gmostly conserved

287Cmostly conserved

340Cmostly conserved

364Tvariable

385Amostly conserved

400Amostly conserved

448Avariable

457Gmostly conserved

487Gmostly conserved

515Cmostly conserved

532Tvariable

544Amostly conserved

553Gvariable

610Tmostly conserved

616Cmostly conserved

ACTTTACTTCATTCTAGGTATTTGATCAGGACTTATTGGTACTATAAGAAGAATTTTAATTCGATCCGAATTAGCTCAACCAGGATCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes24

BINs3

Most divergent pair3.1%

S.AmericaAfricaAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megamelodes quadrimaculatussame family16.7%Conomelus ancepssame family17.0%Euides basilineasame family17.3%Conomelus lorifersame family17.5%Neomegamelanus elongatussame family17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_037182 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Peregrinus maidis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈652 735 292 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Peregrinus maidis0.65 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness93.6% BUSCO

08Occurrence & distribution

Record type331 records

Wild obs. + sensor176

Museum / vouchered155

Range

Area of Occupancy AOO592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 63≤1 km 24≤10 km 8>10 km 30

125 georeferenced · 51 without coordinates

Open the mapobservation + sensor176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	66
National Biodiversity Institute, Costa Ricalocation not on record	28
University Park, US	21
Paris, FR	14
Mangilao, GU	10
College Station, US	4
The University of the West Indies, Trinidad and Tobagolocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
Museo Entomologico de Leonlocation not on record	1
CUlocation not on record	1
Chiba, JP	1
Durban Natural Science Museumlocation not on record	1
North Carolina State University Insect Museumlocation not on record	1
Washington, US	1

14 institutions · 153 of 155 vouchered records shown · 2 without an institution code

09Environmental DNA31 detections

Where the DNA of Peregrinus maidis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys2

Countries6

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 20.4–26.6

Seasonal swing summer↔winter5.40 °C

Max temp (day)25.0 °C 23.2–30.7

Min temp (night)20.4 °C 17.2–22.1

Precipitation329 mm/mo 56.3–387

Air humidity64.3 % 55.4–68.8

Moisture balance256 mm/mo

Vapour deficit959 Pa 890–1,455

Wind speed2.10 m/s

Cloud cover19.6 % 12.5–68.6

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)