Pentzia incana

(Thunb.) Kuntze · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pentzia

At a glance

Occurrence records715

Data sources9

Biological traits28

DNA specimens10

eDNA detections6

Sources9 archives

Databases and archives Pentzia incana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility715 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS · NPASS95 compounds

Occurrence & distributionGBIF715 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Pentzia incana là một loài thực vật có hoa trong họ Cúc. Loài này được (Thunb.) Kuntze mô tả khoa học đầu tiên năm 1898.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFTTRY

Size & morphology12

Fruit length1.8 mm

Leaf length10 mm

Leaf width3.5 mm

Plant height0.4 m

Plant height max1 m

Plant height min0.15 m

Seed mass0.151 mg

Seed mass max0.15 mg

Seed mass min0.15 mg

Seed volume0.52 mm³

Seed volume max0.52 mm³

Seed volume min0.52 mm³

Life cycle & reproduction4

Deciduousnessdeciduous

Dehiscenceindehiscent

Dispersal typewind

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climberself-supporting

Elevation max1 600 m

Elevation min25 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf shapelinear obovate obtriangular spathulate

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)11.66 mm²/mg

03Chemical composition95 compounds

Compounds documented for Pentzia incana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Carotenoids (C40, β-β)10

Germacrane sesquiterpenoids8

Aminoacids4

Carotenoids (C40, β-ε)3

Indole diketopiperazine alkaloids (L-Trp, L-Pro)3

Documented compounds95 total

Tissue Source Quantified only

Compound	Amount	Source
(1R)-3,5,5-trimethyl-4-[(3E,5E,7E,9E,11E,13E,15E,17E)-3,7,12,16-tetramethyl-18-[(1R)-2,6,6-trimethylcyclohex-2-en-1-yl]octadeca-3,5,7,9,11,13,15,17-octaen-1-ynyl]cyclohex-3-en-1-ol	present	NPASS
(1S,2R,4R,5S,7E,11S,12R)-5-hydroxy-4,8,12-trimethyl-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-en-13-one	present	LOTUS
(2R)-2-[(2S,5R,9S)-2-[(S)-[(2R,5R)-5-[(1S,3R,5S)-1-[(2R,5R)-5-[(2R,3E,5E)-6-[(2R,3R,5S)-5-[(2R,3R,4R)-2-hexadecanoyloxy-3-hydroxy-4-methyloxan-2-yl]-3-hydroxyoxolan-2-yl]-2,4-dimethylhexa-3,5-dienyl]-5-methyloxolan-2-yl]-5-methyl-2,8-dioxabicyclo[3.2.1]octan-3-yl]-2-methyl-4-oxooxolan-2-yl]-hydroxymethyl]-1,10-dioxaspiro[4.5]decan-9-yl]propanoic acid	present	NPASS
(2S,3S,4S)-4-[(2E,4E,6S)-6-carboxyhepta-2,4-dien-2-yl]-3-(carboxymethyl)pyrrolidine-2-carboxylic acid	present	NPASS
(2Z,4E,6E,8E,10E,12E,14E,16E)-3-Hydroxy-19-((4R)-4-hydroxy-2,6,6-trimethyl-1-cyclohexen-1-yl)-1-((1R,4S)-4-hydroxy-1,2,2-trimethylcyclopentyl)-4,8,13,17-tetramethyl-2,4,6,8,10,12,14,16-nonadecaoctaen-18-yn-1-one	present	NPASS
(2Z,4E,6E,8E,10E,12E,14E,16E)-3-hydroxy-19-[(4S)-4-hydroxy-2,6,6-trimethylcyclohexen-1-yl]-1-[(1R,4S)-4-hydroxy-1,2,2-trimethylcyclopentyl]-4,8,13,17-tetramethylnonadeca-2,4,6,8,10,12,14,16-octaen-18-yn-1-one	present	NPASS
(3aS,6E,9R,10E,11aR)-9-hydroxy-6,10-dimethyl-3-methylidene-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one	present	LOTUS
(3R,5S)-5-[(1R,4S,6R,7S,9R,10E,12R,17R,19R,20S,29S,32S)-9,32-dihydroxy-6,10,13,19,20,32-hexamethyl-27-methylidene-33,34,35-trioxa-22-azahexacyclo[27.3.1.11,4.14,7.012,17.017,23]pentatriaconta-10,13,22-trien-14-yl]-3-methyloxolan-2-one	present	NPASS
(3R,5S)-5-[(1S,4S,6S,7R,9R,10E,12S,17R,20R,29S,32S)-9,32-dihydroxy-6,10,13,20,32-pentamethyl-27-methylidene-33,34,35-trioxa-22-azahexacyclo[27.3.1.11,4.14,7.012,17.017,23]pentatriaconta-10,13,22-trien-14-yl]-3-methyloxolan-2-one	present	NPASS
(4R,5S)-5-[(1S,2R)-2-hydroxy-5-oxocyclopent-3-en-1-yl]-3-methylidene-4-(2-oxopropyl)oxolan-2-one	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pentzia incana has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences8

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP718434.1 ↗867 bp

ACGT

CGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAAAAACAACCGAGTGTCGATTGGATT …

Pentzia incana voucher NBG:Magee & Boatwright 210 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS7

plant barcodefungal barcode

08Occurrence & distribution

Record type715 records

Wild obs. + sensor359

Museum / vouchered355

Cultivated / captive1

Origin

Native1

Introduced91

Range

Area of Occupancy AOO1 964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 209≤1 km 82≤10 km 8>10 km 7

306 georeferenced · 53 without coordinates

Open the mapobservation + sensor359

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 4≤1 km 20≤10 km 12>10 km 3

39 georeferenced · 316 without coordinates

Open the institutions mapphysical evidence355

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	248
Cape Town, ZA	13
Adelaide, AU	9
ASUlocation not on record	6
Durban, ZA	5
Kew, GB	5
Adam Mickiewicz University in Poznańlocation not on record	4
Canberra, AU	4
Mount Annan, AU	4
Bronx, US	4
University of Stellenboschlocation not on record	4
Canadian Department of Agriculturelocation not on record	3
Phoenix, US	3
South African National Biodiversity Institutelocation not on record	3
MeiseBGlocation not on record	3
Flagstaff, US	2
Stockholm, SE	2
Museo Entomologico de Leonlocation not on record	2
South African National Biodiversity Institutelocation not on record	1
MSB-3054location not on record	1
Saint Louis, US	1
Hobart, AU	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
Görlitz, DE	1
PRClocation not on record	1
GHPG$location not on record	1
Cape Town, ZA	1
Albuquerque, US	1
La Trobe Universitylocation not on record	1

29 institutions · 335 of 355 vouchered records shown · 20 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Pentzia incana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 14.6–21.3

Seasonal swing summer↔winter14.4 °C

Max temp (day)23.7 °C 21.5–28.4

Min temp (night)9.60 °C 7.80–13.4

Precipitation23.3 mm/mo 23.1–33.2

Air humidity49.4 % 46.1–50.8

Moisture balance-109 mm/mo -144–-104

Vapour deficit1,016 Pa 864–1,401

Wind speed3.80 m/s 3.80–5.00

Cloud cover14.4 % 11.7–24.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)