Pentaspadon motleyi

Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Anacardiaceae/Pentaspadon

At a glance

Occurrence records360

Data sources8

Biological traits14

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Pentaspadon motleyi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility360 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionNPASS8 compounds

Occurrence & distributionGBIF360 records

DNA & barcodingNCBIsequences

01Narrative

Pentaspadon motleyi is a species of plant in the family Anacardiaceae. It is found in Indonesia, Malaysia, Papua New Guinea, and the Solomon Islands. It is threatened by habitat loss. Its fruit and its seeds are edible after cooking. Its timber is weak but still used locally for certain applications. It also abundantly produces an oil which is used for skin conditions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height38 m

Plant height max36 m

Life cycle & reproduction3

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Life formtree

Life spanperennial

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza typenon-mycorrhizal

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density550 mg/cm³

03Chemical composition8 compounds

Compounds documented for Pentaspadon motleyi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking🌿 Spice

Compound class profile2 classes

Eudesmane sesquiterpenoids7

Flavanones1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,4aR,5R,8aR)-4a-methyl-8-methylidene-2-propan-2-yl-1,2,3,4,5,6,7,8a-octahydronaphthalene-1,5-diol	present	NPASS
(1R,4aS,6R,8aR)-8a-methyl-4-methylidene-6-propan-2-yl-2,3,4a,5,7,8-hexahydro-1H-naphthalene-1,6-diol	present	NPASS
(4aR,5R,8aS)-5-hydroxy-4a-methyl-8-methylidene-5,6,7,8a-tetrahydro-1H-naphthalen-2-one	present	NPASS
4(15)-Eudesmene-1Beta,5Alpha-Diol	present	NPASS
4(15)-Eudesmene-1Beta,7Alpha-Diol	present	NPASS
4H-1-Benzopyran-4-one, 2-(3,5-dihydroxyphenyl)-2,3-dihydro-7-hydroxy-, (2S)-	present	NPASS
Fgpdtarjoxrwjd-rrfjbimhsa-	present	NPASS
Voleneol	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pentaspadon motleyi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC736541.1 ↗432 bpMalaysia

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGACTATAAATTGACTTATTATACTCCTGAATATGCAACCAAAGATACT …

Pentaspadon motleyi 402042 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type360 records

Wild obs. + sensor158

Museum / vouchered196

Other6

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 155

157 georeferenced · 1 without coordinates

Open the mapobservation + sensor158

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence196

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	10
Cambridge, US	3
Bronx, US	2
South Kensington, GB	2
Llocation not on record	1
Xiamen, CN	1
Cibinong, ID	1
Honolulu, US	1
Fort Worth, US	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
ASUlocation not on record	1

12 institutions · 25 of 196 vouchered records shown · 171 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)