Pentanema hirtum

(L.) D.Gut.Larr., Santos-Vicente, Anderb., E.Rico & M.M.Mart.Ort. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pentanema

At a glance

Occurrence records3 611

Data sources9

Biological traits34

DNA specimens0

eDNA detections32

Sources9 archives

Databases and archives Pentanema hirtum's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 611 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Occurrence & distributionGBIF3 611 records

Environmental DNA1 datasets · 3 countries32 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Pentanema hirtum is a species of perennial herbaceous plant belonging to the family Asteraceae. The specific Latin name hirtum refers to the type of hairiness (bristly and rough) of the plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Plant height0.307 m

Plant height generative0.3 m

Plant height max0.5 m

Plant height min0.25 m

Seed mass0.445 mg

⚠ sources differ — TRY: 0.445 mg · GIFT: 1.12 mg

Seed mass max1.97 mg

Seed mass min0.27 mg

Life cycle & reproduction11

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal type detailedanemochorous

Flowering endJun

Flowering startJun

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedhemicryptophyte

Lifespan years7 years

Pollination modebiotic

Pollination syndromeinsect

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, forest edges, meadows, mountains, shrubberies, steppe

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio21.44 g/g

Leaf c481 mg/g

Leaf dry-matter content (LDMC)277 mg/g

Leaf n24.75 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)21.19 mm²/mg

Other traits1

Diaspore typefruit

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pentanema hirtum has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections32

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKY696566.1 ↗596 bp

ACGT

CAAGCAGAACGACCCGTGAACGTGTAACAACATCCGAGCATCGTAGGGATCGGGCTTTTGCTCATGACCTATTGGCGCCCCGTCGATTTG …

Pentanema hirtum isolate Inuhir3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pentanema hirtum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode16records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1616×CCDB · ita-fl · CCDB · slov-fl · CCDB · fl-europaea +7

CCDB · ita-fl — TONGIORGI E. - 1942. Su la cariologia di alcune Inuleae (Asteraceae).. N. Giorn. Bot. Ital., n.s. , 49(2): 242-251.

CCDB · ita-fl — TONGIORGI E. - 1935. Un primo contributo alla cariologia delle Inuleae. Rendiconto delle sedute e brevi comunicazioni.. N. Giorn. Bot. Ital., n.s. , 42: 261-262.

CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.

CCDB · fl-europaea — Majovsky et al.,

CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.

CCDB · book-ipcn65 — Bauer 1964

CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.

CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.

CCDB · book-ipcn67-71 — HOLUB, J., J. MESICEK, & v. JAVURKOVA. 1971. Annotated chromosome counts of Czechoslovak plants (16-30) (Materials for Flora CSSR-2) Folia Geobot. Phytotax., Praha 6: 179-214.

CCDB · book-atlas-flowering-plants — Tongiorgi 1942

CCDB · Cave1959 — Skal1nska et al. 1959

CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart

CCDB · CromoCat 2015 — Holub, J., Mesícek, J. & Javürková, V. (1971). Annotated chromosome counts of Czechoslovak plants (16-30) (Materials for Flóra CSSR 2). Folia Geobot. Phytotax. (Bohem.) 6: 179-214.

CCDB · CromoCat 2015 — Váchová, M. & A. Murín. (1970). Reports (In Májovsky, J. & al. (ed.) Index of chromosome numbers of slovakian flora. Part 1). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 16: 1-26.

n 82×CCDB · book-ipcn65 · CCDB · CromoCat 2015

CCDB · book-ipcn65 — Bauer 1964

CCDB · CromoCat 2015 — Bauer, Z. (1964). Badania cyto-embriologiczne nad rodzajem Inula L. Acta Biol. Cracov., Ser. Bot. 7: 117-130.

n 01×CCDB · CromoCat 2015

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 611 records

Wild obs. + sensor2 850

Museum / vouchered562

Other199

Range

Area of Occupancy AOO8 000 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 021≤1 km 361≤10 km 79>10 km 46

1 507 georeferenced · 1 343 without coordinates

Open the mapobservation + sensor2 850

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 5≤1 km 47≤10 km 89>10 km 22

163 georeferenced · 399 without coordinates

Open the institutions mapphysical evidence562

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	301
BIO-UNIPIlocation not on record	191
The State Museum-Preserve "The Kulikovo pole"location not on record	26
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	23
Samara National Research Universitylocation not on record	5
Tula State Universitylocation not on record	5
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	4
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	3
GJOlocation not on record	1
Denver, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

11 institutions · 561 of 562 vouchered records shown · 1 without an institution code

09Environmental DNA32 detections

Where the DNA of Pentanema hirtum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 10.2–17.2

Seasonal swing summer↔winter21.8 °C

Max temp (day)16.7 °C 14.4–19.8

Min temp (night)9.80 °C 5.40–16.0

Precipitation82.0 mm/mo 39.9–93.8

Air humidity61.5 % 57.5–64.4

Moisture balance-36.5 mm/mo -62.9–18.4

Vapour deficit623 Pa 473–752

Wind speed3.70 m/s 2.70–5.70

Cloud cover40.5 % 35.1–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pentanema hirtum

At a glance

Sources9 archives

Size & morphology7

Life cycle & reproduction11

Diet & foraging1

Habitat & environment8

Physiology & chemistry6

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 611 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 611 records