Pentadesma butyracea

Sabine · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Pentadesma

At a glance

Occurrence records981

Data sources13

Biological traits26

DNA specimens10

eDNA detections8

Sources13 archives

Databases and archives Pentadesma butyracea's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility981 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF981 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceGoaTgenome

01Narrative

Pentadesma butyracea is a tree native to the forests of tropical Africa from Sierra Leone to Cameroon. It has multiple uses, the main one being the manufacture of a kind of butter called "kpangnan butter" similar to shea butter. The timber is used in cabinetmaking and construction. It is sometimes called African butter tree.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Plant height25 m

Plant height max22.86 m

Seed mass33 333 mg

Seed mass max33 333 mg

Seed mass min33 333 mg

Seed volume14 000 mm³

Seed volume max14 000 mm³

Seed volume min14 000 mm³

Life cycle & reproduction7

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Life formtree

Life spanperennial

Pollination syndromeother

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeberry

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density806 mg/cm³

03Chemical composition30 compounds

Compounds documented for Pentadesma butyracea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Plant xanthones30

Methyl xanthones $ Plant xanthones3

Friedelane triterpenoids1

Flavan-3-ols1

Ursane and Taraxastane triterpenoids1

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3R,9R,11R)-7-(3,4-dihydroxybenzoyl)-4,4,10,10-tetramethyl-3,9,11-tris(3-methylbut-2-enyl)-5-oxatricyclo[7.3.1.01,6]tridec-6-ene-8,13-dione	present	LOTUS
(2R)-2,5,9,11-tetrahydroxy-3,3-dimethyl-6,10-bis(3-methylbut-2-enyl)-1,2-dihydropyrano[3,2-a]xanthen-12-one	present	LOTUS
1,5-Dihydroxyxanthone	present	LOTUS
1,6-Dihydroxy-3,7-dimethoxy-2-(3-methyl-2-butenyl)-8-(3-hydroxy-3-methyl-1E-butenyl)-xanthone	present	LOTUS
1-(3,7-Dimethylocta-2,6-dienyl)-3,6,8-trihydroxy-2-methoxyxanthen-9-one	present	LOTUS
1-[(2Z)-3,7-dimethylocta-2,6-dienyl]-3,6,8-trihydroxy-2-methoxyxanthen-9-one	present	LOTUS
2-(3,7-Dimethylocta-2,6-dienyl)-1,3,6-trihydroxy-7-methoxy-8-(3-methylbut-2-enyl)xanthen-9-one	present	LOTUS
3,6,8-Trihydroxy-1-(7-hydroxy-3,7-dimethyloct-2-enyl)-2-methoxyxanthen-9-one	present	LOTUS
3-Isomangostin	present	LOTUS
4,8-Dihydroxy-2-(2-hydroxypropan-2-yl)-7-methoxy-6-(3-methylbut-2-enyl)furo[3,2-b]xanthen-5-one	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pentadesma butyracea has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes6

GenBank sequences5

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSEU128369.1 ↗685 bp

ACGT

AGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCCCAGCAGCACGACCCGTGAACTCG …

Pentadesma butyracea voucher P. Sweeney 1005 MO 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Pentadesma butyracea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type981 records

Wild obs. + sensor649

Museum / vouchered324

Other8

Origin

Introduced14

Range

Area of Occupancy AOO1 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 72≤1 km 5≤10 km 2>10 km 1

80 georeferenced · 569 without coordinates

Open the mapobservation + sensor649

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 2≤10 km 4>10 km 1

7 georeferenced · 317 without coordinates

Open the institutions mapphysical evidence324

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BRLUlocation not on record	41
Saint Louis, US	31
LBVlocation not on record	30
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	19
Kew, GB	17
WAGlocation not on record	16
LaCarto/IGATE/UAClocation not on record	11
Yaoundé, CM	10
Herbier National du Gabonlocation not on record	10
Plocation not on record	8
LSF/FSA/UAClocation not on record	7
Université du Lomélocation not on record	6
HNBlocation not on record	5
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	5
Brussels, BE	3
CJBGlocation not on record	3
MeiseBGlocation not on record	2
Frankfurt am Main	2
University of Santo Tomas Museumlocation not on record	2
Universite Libre de Bruxelles, Herbariumlocation not on record	2
Universite Libre de Bruxelleslocation not on record	2
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	2
Bronx, US	2
Llocation not on record	1
Chongqing Museumlocation not on record	1
Paris, FR	1
Pondicherry, IN	1
Daubeny Herbarium, Oxfordlocation not on record	1
CNF-UFHBlocation not on record	1
Seychelles National Herbariumlocation not on record	1
IPHAMETRAlocation not on record	1
Pretoria, ZA	1
Université Nangui Abrogoualocation not on record	1
Uppsala, SE	1
Institut Botanique Ake-Assi d'Andokoilocation not on record	1

35 institutions · 248 of 324 vouchered records shown · 76 without an institution code

09Environmental DNA8 detections

Where the DNA of Pentadesma butyracea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.4–26.6

Seasonal swing summer↔winter2.80 °C

Max temp (day)29.0 °C 28.1–31.1

Min temp (night)21.9 °C 21.7–23.0

Precipitation156 mm/mo 76.7–321

Air humidity69.6 % 68.5–73.8

Moisture balance43.4 mm/mo -54.6–211

Vapour deficit962 Pa 801–1,089

Wind speed1.00 m/s 1.00–2.30

Cloud cover22.6 % 16.0–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)