Pentachaeta aurea

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pentachaeta

At a glance

Occurrence records465

Data sources10

Biological traits8

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Pentachaeta aurea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility465 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF465 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Pentachaeta aurea là một loài thực vật có hoa trong họ Cúc. Loài này được Nutt. mô tả khoa học đầu tiên năm 1840.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pentachaeta aurea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF046972.1 ↗633 bp

ACGT

TCGAAGCCTGCAAAAGCAGAACGACCCGTGAACATGTTATAACAACAATGTCAGGATGGGTCGGGCATTAGTTCGATTCGCCTGACACCC …

Pentachaeta aurea internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pentachaeta aurea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Solbrig at al. 1964

n 91×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — VAN HORN, G.S. 1973. The taxonomic status of Pentachaeta and Chaetopappa with a revision of Pentachaeta. Univ. Calif. Publ. Bot. 65: 1 41.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type465 records

Wild obs. + sensor120

Museum / vouchered345

Range

Area of Occupancy AOO920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 46≤1 km 3≤10 km 2>10 km 27

78 georeferenced · 42 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 44≤1 km 62≤10 km 97>10 km 7

210 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence345

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	116
Claremont, US	90
Riverside, US	37
Los Angeles, US	12
Santa Barbara, US	12
US	9
Irvine, US	5
CASlocation not on record	5
Bronx, US	3
Philadelphia, US	3
Long Beach, US	3
San Luis Obispo, US	3
Pomona Collegelocation not on record	2
Mexico City, MX	2
Phoenix, US	2
Pullman, US	2
Flagstaff, US	1
Northridge, US	1
Logan, US	1
Davis, US	1
Ensenada, MX	1
Severin-McDaniel Insect Collectionlocation not on record	1
Bloomington, US	1

23 institutions · 313 of 345 vouchered records shown · 32 without an institution code

09Environmental DNA2 detections

Where the DNA of Pentachaeta aurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 19.9–19.9

Seasonal swing summer↔winter14.8 °C

Max temp (day)28.2 °C

Min temp (night)13.0 °C

Precipitation2.90 mm/mo

Air humidity49.2 %

Moisture balance-181 mm/mo

Vapour deficit1,190 Pa

Wind speed2.90 m/s

Cloud cover16.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)