Pentaceras australe

(F.Muell.) Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Pentaceras

At a glance

Occurrence records171

Data sources10

Biological traits33

DNA specimens4

eDNA detections1

Sources10 archives

Databases and archives Pentaceras australe's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility171 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF171 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Winged seeds Pentaceras australe, commonly known as bastard crow's ash, penta ash or black teak, is the only species in the genus Pentaceras in the plant family Rutaceae. It is a small to medium-sized rainforest tree endemic to eastern Australia. It has pinnate leaves with up to fifteen leaflets, small white flowers arranged in panicles on the ends of branchlets, and winged seeds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology15

Fruit length40 mm

Fruit width15 mm

Leaf length150 mm

Leaf length max500 mm

Leaf length min150 mm

Leaf mass per area79.74 g/m2

Leaf size29 675 mm²

Leaf width32.5 mm

Leaf width max65 mm

Leaf width min7 mm

Petiole length15.5 cm

Plant height26 m

Plant height max25 m

Seed length6 mm

Seed width4.5 mm

Life cycle & reproduction6

Flowering endNov

Flowering startAug

Flowering timennnnnyyyyynn

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typesamara

Growth formtree

Leaf compoundnesscompound

Leaf shapelanceolate ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition14 compounds

Compounds documented for Pentaceras australe across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Carbazole alkaloids6

Carboline alkaloids2

Pyranocoumarins $ Simple coumarins1

Benzodiazepine alkaloids1

Anthraquinones and anthrones1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(E)-2-methyl-N-[2-(16-oxo-18-thia-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1(20),3,5,7,9(21),10,12,14(19)-octaen-20-yl)ethyl]but-2-enamide	present	NPASS
(E)-2-methyl-N-[2-(4-thia-6,9,19-triazapentacyclo[10.7.1.03,7.08,20.013,18]icosa-1,3(7),5,8,10,12(20),13,15,17-nonaen-2-yl)ethyl]but-2-enamide	present	NPASS
(E)-N-(13-hydroxy-8,15-diazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-1(18),2,4,6,9,11(19),12,14,16-nonaen-9-yl)-2-methylbut-2-enamide	present	NPASS
20-[2-(Dimethylamino)ethyl]-18-thia-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1(20),3,5,7,9(21),10,12,14(19)-octaen-16-one	present	NPASS
6H-Indolo[3,2,1-de][1,5]naphthyridin-6-one, 4-(methylthio)-	present	LOTUS
Canthin-6-One	present	LOTUS
Cycloshermilamine D	present	NPASS
Dehydrokuanoniamine B	present	NPASS
N,N-dimethyl-2-(16-oxo-18-thia-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1(20),3,5,7,9(21),10,12,14(19)-octaen-20-yl)ethanamine oxide	present	NPASS
N-(13-hydroxy-8,15-diazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-1(18),2,4,6,9,11(19),12,14,16-nonaen-9-yl)-3-methylbut-2-enamide	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pentaceras australe has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHG971442.1 ↗391 bp

ACGT

GCATCGATGAGAACGCAGCGAAATGCGATACTTGGTGTAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAA …

Pentaceras australe genomic DNA containing 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene, specimen voucher Forster 28897

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type171 records

Wild obs. + sensor166

Museum / vouchered5

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 74≤1 km 5≤10 km 5>10 km 33

117 georeferenced · 49 without coordinates

Open the mapobservation + sensor166

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Auckland, NZ	2

2 institutions · 4 of 5 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Pentaceras australe was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C

Min temp (night)14.4 °C

Precipitation132 mm/mo

Air humidity61.0 %

Moisture balance13.6 mm/mo

Vapour deficit823 Pa

Wind speed3.10 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)