Penstemon virens

Pennell ex Rydb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records3 693

Data sources9

Biological traits9

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Penstemon virens's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 693 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF3 693 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT817 Mbp

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.59 mg

Seed mass max0.59 mg

Seed mass min0.59 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

Woodinessvariable

03Chemical composition10 compounds

Compounds documented for Penstemon virens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Iridoids monoterpenoids6

Acyclic monoterpenoids4

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4aS,5R,7R,7aR)-5-[(3E,7E)-3,7-dimethyl-2,9-dioxonona-3,7-dienoxy]-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carbaldehyde	present	LOTUS
(1S,4aS,5R,7R,7aR)-5-[(3E,7E)-9-hydroxy-3,7-dimethyl-2-oxonona-3,7-dienoxy]-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carbaldehyde	present	LOTUS
(1S,4aS,5R,7R,7aR)-5-[(3E,7Z)-3,7-dimethyl-2,9-dioxonona-3,7-dienoxy]-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carbaldehyde	present	LOTUS
[(1S,2S,4S,5S,6S,10S)-5-hydroxy-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-2-yl]methyl benzoate	present	LOTUS
[(2E,6E)-1-Oxo-8-hydroxy-2,6-dimethylocta-2,6-dien-1-yl]beta-D-glucopyranoside	present	LOTUS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (2E,5R,6E)-5,8-dihydroxy-2,6-dimethylocta-2,6-dienoate	present	LOTUS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (2E,6E)-2,6-dimethyl-8-oxoocta-2,6-dienoate	present	LOTUS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (2E,6Z)-2,6-dimethyl-8-oxoocta-2,6-dienoate	present	LOTUS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (4aS,5R,7R,7aR)-5-hydroxy-7-methyl-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylate	present	LOTUS
Geniposidic Acid	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon virens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ531187.1 ↗603 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGCCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGTCCCT …

Penstemon virens internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Penstemon virens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size816 630 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon virens0.82 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Freeman, C. C. 1983. Chromosome numbers in Great Plains species of Penstemon (Scrophulariaceae). Brittonia 35(3): 232–238.

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

n 82×CCDB · ipcn-api-dl · CCDB · Cave1962

CCDB · ipcn-api-dl — Freeman, C. C. 1983. Chromosome numbers in Great Plains species of Penstemon (Scrophulariaceae). Brittonia 35(3): 232–238.

CCDB · Cave1962 — Wiens & H. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 693 records

Wild obs. + sensor3 120

Museum / vouchered570

Cultivated / captive3

Range

Area of Occupancy AOO4 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 1 763≤1 km 316≤10 km 178>10 km 88

2 345 georeferenced · 775 without coordinates

Open the mapobservation + sensor3 120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 29≤1 km 99≤10 km 148>10 km 19

295 georeferenced · 275 without coordinates

Open the institutions mapphysical evidence570

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	117
Denver, US	96
Musee des Dinosaures d'Esperaza (Aude)location not on record	92
DOI/NPS, Colonial National Historical Parklocation not on record	87
Wuzhou, CN	37
Pullman, US	19
Albuquerque, US	14
DOI/NPS, Greenbelt Parklocation not on record	13
Claremont, US	11
Chadron, US	9
Flagstaff, US	8
Provo, US	8
Grand Junction, US	7
Saint Louis, US	7
Riverside, US	6
San Luis Obispo, US	6
University of Stellenboschlocation not on record	5
Chongqing Museumlocation not on record	3
Tempe, US	3
Dekalb, US	2
Logan, US	2
Canadian Department of Agriculturelocation not on record	2
Rocky Mountain Biological Laboratorylocation not on record	1
CASlocation not on record	1
University of Lethbridgelocation not on record	1
Pittsburg, US	1
Los Angeles, US	1
Moscow, US	1
Northridge, US	1
AUAlocation not on record	1
Burlington, US	1
BAYLUlocation not on record	1
Tuscaloosa, US	1
University of Alberta Museumslocation not on record	1
Durango, US	1
ASUlocation not on record	1

36 institutions · 568 of 570 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon virens

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction2

Habitat & environment4

Compound class profile2 classes

Documented compounds10 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 693 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 36 geolocated

Cultivated / Captivenot free-living

Record type3 693 records