Penstemon venustus

Douglas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records221

Data sources7

Biological traits88

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Penstemon venustus's data was compiled from.

GBIFGlobal Biodiversity Information Facility221 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources88 traits

Occurrence & distributionGBIF221 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT2 Gbp

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height0.61 m

Seed mass0.515 mg

Life cycle & reproduction24

After harvest regrowth rateRapid

Bloom periodEarly Summer

Coppice potentialNo

Flower colourpurple

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDARapid

Life formsubshrub

Life spanperennial

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateRapid

Seedling vigorHigh

Vegetative spread rateNone

Habitat & environment22

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

BloatNone

Climatetemperate

Climberself-supporting

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formSubshrub, Shrub, Forb/herb

Growth form USDAMultiple Stem

Hedge toleranceMedium

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min6 in

Shape and orientationErect

Small grainNo

Woodinessvariable

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredYes

Drought toleranceNone

Fertility requirementLow

Fire resistantNo

Fire toleranceLow

Frost free days min170 days

Moisture useMedium

Nitrogen fixation levelNone

Precipitation max69 in

Precipitation min9 in

Protein potentialHigh

Salinity toleranceNone

Shade toleranceMedium

Soil pH max8 pH

Soil pH min6.8 pH

Temperature min-18 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalHigh

Palatable graze animalHigh

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound880 000 per lb

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousYes

Fruit seed persistenceNo

Planting density max4 800 per acre

Planting density min1 700 per acre

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon venustus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ531185.1 ↗603 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGCCGAGGCGCGAGGGTCGCAAGTCCCCCTCGCCGACGCCCCT …

Penstemon venustus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Penstemon venustus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 995 120 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon venustus2 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Ploidy8× octoploid · measured

Chromosome records64–642n range64median64mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 642×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

octoploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type221 records

Wild obs. + sensor128

Museum / vouchered92

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 74≤1 km 11≤10 km 2>10 km 3

90 georeferenced · 38 without coordinates

Open the mapobservation + sensor128

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 8≤1 km 16≤10 km 39>10 km 1

64 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence92

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	67
Wuzhou, CN	10
University of Stellenboschlocation not on record	4
Claremont, US	3
Beijing, CN	2
Riverside, US	2
Vancouver, CA	1
US	1
Kew, GB	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1

10 institutions · 92 of 92 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)