Penstemon speciosus

Douglas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records2 090

Data sources9

Biological traits89

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Penstemon speciosus's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 090 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources89 traits

Occurrence & distributionGBIF2 090 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT743 Mbp

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.76 m

⚠ sources differ — GIFT: 0.76 m · USDA: 0.762 m · TRY: 0.481 m

Seed mass1.85 mg

⚠ sources differ — TRY: 1.85 mg · GIFT: 1.49 mg

Seed mass max2.63 mg

Seed mass min1.13 mg

Life cycle & reproduction25

After harvest regrowth rateSlow

Bloom periodMid Summer

Coppice potentialNo

Flower colourblue

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endSummer

Growth rate USDAModerate

Life formperennial

Life spanperennial

Lifespan categoryLong

Lifespan years13 years

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGray-Green

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formherb

Growth form USDAMultiple Stem

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min14 in

Shape and orientationSemi-Erect

Small grainNo

Woodinessnon-woody

Physiology & chemistry18

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min110 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max24 in

Precipitation min8 in

Salinity toleranceNone

Shade toleranceHigh

Soil pH max8 pH

Soil pH min6.4 pH

Temperature min-33 °F

Uses & economy13

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound400 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon speciosus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF375179.1 ↗602 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGCCCCT …

Penstemon speciosus internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Penstemon speciosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size743 280 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon speciosus0.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 090 records

Wild obs. + sensor1 514

Museum / vouchered576

Origin

Native99

Range

Area of Occupancy AOO5 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 907≤1 km 148≤10 km 68>10 km 42

1 165 georeferenced · 349 without coordinates

Open the mapobservation + sensor1 514

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 14≤1 km 105≤10 km 149>10 km 12

280 georeferenced · 296 without coordinates

Open the institutions mapphysical evidence576

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	227
WTUlocation not on record	163
Claremont, US	106
Wuzhou, CN	24
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	24
Angwin, US	12
EL PASO, US	5
Vancouver, CA	3
Davis, US	3
University of Stellenboschlocation not on record	2
Mexico City, MX	1
Mexico City, MX	1
Logan, US	1
Chadron, US	1
Kew, GB	1
Madison, US	1
ASUlocation not on record	1

17 institutions · 576 of 576 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Penstemon speciosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon speciosus

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction25

Diet & foraging1

Habitat & environment24

Physiology & chemistry18

Uses & economy13

Other traits4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 090 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 090 records