Penstemon serrulatus

Menzies · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records1 641

Data sources10

Biological traits9

DNA specimens5

eDNA detections4

Sources10 archives

Databases and archives Penstemon serrulatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 641 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Chemical compositionNPASS18 compounds

Occurrence & distributionGBIF1 641 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT523 Mbp

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.29 mg

Seed mass max0.29 mg

Seed mass min0.29 mg

Life cycle & reproduction2

Life formperennial or subshrub

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessvariable

03Chemical composition18 compounds

Compounds documented for Penstemon serrulatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Pregnane steroids $ Steroidal alkaloids8

Pregnane steroids6

Steroidal alkaloids1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(3R)-1-[(3S,5R,8R,9S,10R,13S,14S,16R,17S)-17-[(1S)-1-(dimethylamino)ethyl]-16-hydroxy-10,13-dimethyl-4-oxo-1,2,3,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-3-yl]-3-propan-2-ylazetidin-2-one	present	NPASS
(3R)-1-[(5S,8R,9S,10R,13S,14S,16R,17S)-17-[(1S)-1-(dimethylamino)ethyl]-16-hydroxy-10,13-dimethyl-4-oxo-1,5,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-yl]-3-propan-2-ylazetidin-2-one	present	NPASS
(3R)-1-[(5S,8S,9S,10R,13S,14S,17S)-17-[(1S)-1-(dimethylamino)ethyl]-10,13-dimethyl-4-oxo-1,5,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-yl]-3-propan-2-ylazetidin-2-one	present	NPASS
(3R,5R,8R,9S,10S,13S,14S,17S)-17-[(1S)-1-(dimethylamino)ethyl]-2',10,13-trimethylspiro[1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-3,3'-isoindole]-1'-one	present	NPASS
[(2R,3S,4R,5S,8S,9S,10R,13S,14S,17S)-17-[(1S)-1-(dimethylamino)ethyl]-3-(1,3-dioxoisoindol-2-yl)-2-hydroxy-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-4-yl] acetate	present	NPASS
[(3R,4R,5R,8S,9S,10R,13S,14S,17S)-17-[(1S)-1-(dimethylamino)ethyl]-10,13-dimethyl-3-[methyl(3-methylbut-2-enoyl)amino]-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-4-yl] acetate	present	NPASS
[(3R,5S,8R,9S,10S,12R,13S,14S,17S)-3-[benzoyl(methyl)amino]-17-[(1S)-1-(dimethylamino)ethyl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-12-yl] acetate	present	NPASS
[(4R,5S,8S,9S,10R,13S,14S,17S)-3-benzamido-17-[(1S)-1-(dimethylamino)ethyl]-10,13-dimethyl-4,5,6,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-4-yl] acetate	present	NPASS
IJOMVKHDFSLVTI-MEJJHQGZSA-N	present	NPASS
MIBNSJGPBDCICQ-NELQOVGMSA-N	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon serrulatus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ531170.1 ↗573 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGCCGAGGCGCGAGGGTCGCAAGTCCCCCGCGCCGACGCCCCT …

Penstemon serrulatus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Penstemon serrulatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size523 230 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon serrulatus0.52 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Baker, M. A. & B. D. Parfitt. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 764–765.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 641 records

Wild obs. + sensor1 603

Museum / vouchered38

Range

Area of Occupancy AOO3 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 899≤1 km 161≤10 km 84>10 km 67

1 211 georeferenced · 392 without coordinates

Open the mapobservation + sensor1 603

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	13
Wuzhou, CN	6
University of Stellenboschlocation not on record	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
University of Guelph, OAC Herbariumlocation not on record	2
Riverside, US	1
Québec, CA	1
University of British Columbialocation not on record	1
Moscow State Universitylocation not on record	1
Canadian Department of Agriculturelocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Angwin, US	1

12 institutions · 35 of 38 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Penstemon serrulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 9.40–12.2

Seasonal swing summer↔winter19.1 °C

Max temp (day)18.2 °C 15.5–19.3

Min temp (night)5.50 °C 3.90–6.40

Precipitation55.7 mm/mo 45.5–69.4

Air humidity56.2 % 56.1–57.2

Moisture balance-87.7 mm/mo -91.4–-57.0

Vapour deficit589 Pa 512–629

Wind speed3.70 m/s 3.20–4.50

Cloud cover34.5 % 34.2–35.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon serrulatus

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction2

Habitat & environment4

Compound class profile3 classes

Documented compounds18 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 641 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 641 records