Penstemon saxosorum

Pennell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records145

Data sources3

Biological traits9

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Penstemon saxosorum's data was compiled from.

GBIFGlobal Biodiversity Information Facility145 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF145 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon saxosorum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ531165.1 ↗602 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGCCCCT …

Penstemon saxosorum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type145 records

Wild obs. + sensor21

Museum / vouchered124

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 15≤1 km 1

16 georeferenced · 5 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 13≤1 km 21≤10 km 25>10 km 3

62 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence124

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	33
DOI/NPS, Colonial National Historical Parklocation not on record	24
Musee des Dinosaures d'Esperaza (Aude)location not on record	13
Wuzhou, CN	11
Denver, US	11
Provo, US	5
Riverside, US	4
Grand Junction, US	4
WTUlocation not on record	3
Pullman, US	2
Saint Louis, US	2
DOI/NPS, Greenbelt Parklocation not on record	2
Pomona Collegelocation not on record	1
Lincoln, US	1
Claremont, US	1
Northridge, US	1
San Angelo, US	1
Logan, US	1
Durango, US	1
Moscow, US	1
ASUlocation not on record	1
Chongqing Museumlocation not on record	1

22 institutions · 124 of 124 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)