Penstemon richardsonii

Douglas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records759

Data sources7

Biological traits9

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Penstemon richardsonii's data was compiled from.

GBIFGlobal Biodiversity Information Facility759 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Chemical compositionNPASS9 compounds

Occurrence & distributionGBIF759 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed mass0.14 mg

Seed mass max0.14 mg

Seed mass min0.14 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

03Chemical composition9 compounds

Compounds documented for Penstemon richardsonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Friedelane triterpenoids3

Stigmastane steroids2

Lupane triterpenoids2

Oleanane triterpenoids1

Friedelane triterpenoids $ Pachysanane triterpenoids $ Taraxerane triterpenoids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3aR,5aR,5bR,7S,7aR,9S,11aR,11bR,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-7,9-diol	present	NPASS
(2S,3R,4S,5S,6R)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(4R,4aS,6aS,6aS,6bR,8aR,12aR,14aS,14bS)-4,4a,6a,6b,8a,11,11,14a-octamethyl-1,2,4,5,6,6a,8,9,10,12,12a,13,14,14b-tetradecahydropicene-3,7-dione	present	NPASS
[(3S,4aR,6aR,6bS,8aR,12aR,14aR,14bS)-4,4,6a,6b,8a,11,11,14b-octamethyl-14-oxo-2,3,4a,5,6,7,8,9,10,12,12a,14a-dodecahydro-1H-picen-3-yl] (E)-3-(3,5-dihydroxyphenyl)prop-2-enoate	present	NPASS
beta-Sitosterol	present	NPASS
Epifriedelanol	present	NPASS
Friedelin	present	NPASS
Lupeol	present	NPASS
Putranjivadione	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon richardsonii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ471687.1 ↗338 bp

ACGT

GCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCG …

Penstemon richardsonii 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type759 records

Wild obs. + sensor681

Museum / vouchered78

Range

Area of Occupancy AOO1 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 459≤1 km 53≤10 km 15>10 km 17

544 georeferenced · 137 without coordinates

Open the mapobservation + sensor681

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 3≤1 km 11≤10 km 45>10 km 2

61 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	55
Cheney, US	8
Victoria, CA	6
Denver, US	2
ASUlocation not on record	2
Vancouver, CA	1
University of Guelph, OAC Herbariumlocation not on record	1
Austin, US	1
Angwin, US	1

9 institutions · 77 of 78 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Penstemon richardsonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-0.2 °C -0.2–-0.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)5.00 °C

Min temp (night)-5.10 °C

Precipitation57.6 mm/mo

Air humidity57.2 %

Moisture balance1.30 mm/mo

Vapour deficit261 Pa

Wind speed4.70 m/s

Cloud cover49.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)