Penstemon neomexicanus

Wooton & Standl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records342

Data sources4

Biological traits10

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Penstemon neomexicanus's data was compiled from.

GBIFGlobal Biodiversity Information Facility342 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF342 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.92 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Penstemon neomexicanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Delphinidin 3,5-diglucoside		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon neomexicanus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ531131.1 ↗603 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGCCCCT …

Penstemon neomexicanus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type342 records

Wild obs. + sensor277

Museum / vouchered65

Range

Area of Occupancy AOO592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 192≤1 km 11≤10 km 8>10 km 15

226 georeferenced · 51 without coordinates

Open the mapobservation + sensor277

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 6≤1 km 14≤10 km 21>10 km 4

45 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	19
EL PASO, US	17
Wuzhou, CN	15
Claremont, US	5
Riverside, US	4
Pomona Collegelocation not on record	1
Taipei, TW	1
University of Stellenboschlocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Saint Louis, US	1

10 institutions · 65 of 65 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)