Penstemon linarioides

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records738

Data sources13

Biological traits18

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Penstemon linarioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility738 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF738 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Penstemon linarioides is a plant species in the genus Penstemon. Its common names include toadflax penstemon, toadflax beardtongue and Colorado narrowleaf beardtongue. It grows in Nevada, Arizona, Utah, Colorado, and New Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.124 m

Seed mass1.31 mg

⚠ sources differ — TRY: 1.31 mg · GIFT: 1.2 mg

Seed mass max1.2 mg

Seed mass min1.2 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formsubshrub

Life spanperennial

Lifespan years5 years

Habitat & environment4

Climatesubtropical

Climberself-supporting

Growth formHS

Woodinessvariable

Physiology & chemistry6

Leaf c476 mg/g

Leaf dry-matter content (LDMC)274 mg/g

Leaf n11.9 mg/g

Leaf p1.38 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)6.94 mm²/mg

03Chemical composition15 compounds

Compounds documented for Penstemon linarioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Cinnamic acids and derivatives $ Phenylethanoids18

Anthocyanidins3

Iridoids monoterpenoids1

Flavonols1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
[(2R,3R,4R,5R,6R)-5-hydroxy-6-[2-(3-hydroxy-4-methoxyphenyl)ethoxy]-4-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-3-yl] (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate	present	LOTUS
[(2R,3R,4R,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3-hydroxy-4-methoxyphenyl)prop-2-enoate	present	LOTUS
Calceolarioside A	present	LOTUS
Calceolarioside B	present	LOTUS
Cistanoside D	present	LOTUS
cyanidin-3,5-diglucoside	present	LOTUS
Delphinidin 3,5-diglucoside	present	LOTUS
Forsythoside A	present	LOTUS
Leucosceptoside A	present	LOTUS
Plantainoside D	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon linarioides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ471686.1 ↗225 bp

ACGT

GCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCCAGTCTTTGAACGCAAGTTGCGCCCG …

Penstemon linarioides 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Penstemon linarioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 82×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Spellenberg, R. 1986. Chromosome Number Reports 90. Taxon 35: 197.

CCDB · ipcn-api-dl — Freeman, C. C. & R. E. Brooks. 1988. Documented plant chromosome numbers 1988: 1. Chromosome counts for North American plants -- I. Sida 13: 241–250.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type738 records

Wild obs. + sensor456

Museum / vouchered282

Origin

Native4

Range

Area of Occupancy AOO2 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 258≤1 km 47≤10 km 28>10 km 19

352 georeferenced · 104 without coordinates

Open the mapobservation + sensor456

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 18≤1 km 64≤10 km 54>10 km 11

147 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence282

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	38
Albuquerque, US	28
ASUlocation not on record	22
Riverside, US	19
EL PASO, US	16
Phoenix, US	15
Flagstaff, US	15
Durango, US	15
Denver, US	12
USFSlocation not on record	10
Provo, US	9
Bronx, US	8
Claremont, US	8
Logan, US	7
WTUlocation not on record	6
Chongqing Museumlocation not on record	6
Eastern Nevada Landscape Coalitionlocation not on record	6
Bureau of Land Managementlocation not on record	5
Boise, US	5
Mexico City, MX	4
University of Stellenboschlocation not on record	3
San Diego, US	3
US	2
Grand Junction, US	2
Orem, US	2
San Luis Obispo, US	2
Henderson, US	1
Chadron, US	1
Saint Louis, US	1
Moscow, US	1
Rocky Mountain Biological Laboratorylocation not on record	1
Davenport, US	1
Pittsburg, US	1
Weber State Universitylocation not on record	1
Mexico City, MX	1
Bangkok, TH	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Bloomington, US	1
SEINetlocation not on record	1
Santa Barbara, US	1

40 institutions · 282 of 282 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Penstemon linarioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)