Penstemon laetus

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records974

Data sources10

Biological traits87

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Penstemon laetus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility974 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources87 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF974 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaTgenome

01Narrative

Penstemon laetus is a species of penstemon known by the common names mountain blue penstemon and gay penstemon. It is native to the inland mountains of Oregon and California, where its distribution extends from the Klamath Mountains through the Sierra Nevada to the Transverse Ranges. It grows in forest, scrub, and other local mountain habitat. It is a perennial herb growing erect to about 75 centimeters tall, its base becoming woody. The leaves are linear to lance-shaped and up to 10 centimeters long. The glandular inflorescence bears blue or purple flowers up to 3.5 centimeters long. The wide-mouthed tubular or funnel-shaped flower is glandular on the outer surface and mostly hairless on the inside.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.76 m

⚠ sources differ — GIFT: 0.76 m · USDA: 0.762 m · TRY: 0.686 m

Seed mass1.75 mg

⚠ sources differ — TRY: 1.75 mg · GIFT: 1.12 mg

Seed mass max1.83 mg

Seed mass min0.408 mg

Life cycle & reproduction23

Bloom periodLate Spring

Coppice potentialNo

Flower colourblue

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endSummer

Growth rate USDAModerate

Life formperennial or subshrub

Life spanperennial

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateNone

Habitat & environment22

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

BloatNone

Climatetemperate

Climberself-supporting

Foliage colorGray-Green

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formSubshrub, Forb/herb

Growth form USDASingle Crown

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min12 in

Shape and orientationErect

Small grainNo

Woodinessvariable

Physiology & chemistry18

Anaerobic toleranceNone

C:N ratioHigh

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementMedium

Fire resistantNo

Fire toleranceMedium

Frost free days min150 days

Moisture useMedium

Nitrogen fixation levelNone

Precipitation max20 in

Precipitation min12 in

Salinity toleranceNone

Shade toleranceHigh

Soil pH max7.6 pH

Soil pH min6 pH

Temperature min12 °F

Uses & economy13

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound400 000 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

Height at 20yr0.61 m

Planting density max2 700 per acre

Planting density min1 700 per acre

03Chemical composition3 compounds

Compounds documented for Penstemon laetus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins3

Documented compounds3 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Delphinidin 3,5-diglucoside		present	LOTUS
Delphinidin 3-glucoside		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon laetus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ531119.1 ↗573 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGCCGCAAGTCCCCCGCGTCGACGCCCCT …

Penstemon laetus var. laetus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Penstemon laetus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type974 records

Wild obs. + sensor757

Museum / vouchered217

Origin

Native15

Range

Area of Occupancy AOO2 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 455≤1 km 90≤10 km 60>10 km 25

630 georeferenced · 127 without coordinates

Open the mapobservation + sensor757

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 5≤1 km 56≤10 km 65>10 km 6

132 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence217

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	33
Angwin, US	21
Claremont, US	17
US	17
Riverside, US	15
Davis, US	14
San Luis Obispo, US	11
EL PASO, US	7
Northridge, US	6
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	5
Long Beach, US	5
Canadian Department of Agriculturelocation not on record	4
ASUlocation not on record	4
San Francisco, US	4
WTUlocation not on record	4
Flagstaff, US	4
CASlocation not on record	3
Bronx, US	3
San Diego, US	3
Fredericton Stock Culture Collectionlocation not on record	3
Arcata, US	3
Los Angeles, US	3
Mexico City, MX	2
Moscow, US	2
Chongqing Museumlocation not on record	2
Henderson, US	1
Vancouver, CA	1
Truckee, US	1
Phoenix, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
STNFlocation not on record	1
Pullman, US	1
Turlock, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
University of Stellenboschlocation not on record	1

35 institutions · 205 of 217 vouchered records shown · 12 without an institution code

09Environmental DNA1 detections

Where the DNA of Penstemon laetus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)