Penstemon labrosus

(A.Gray) Mast. ex Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records1 102

Data sources11

Biological traits9

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Penstemon labrosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF1 102 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT773 Mbp

01Narrative

Penstemon labrosus là một loài thực vật có hoa trong họ Mã đề. Loài này được Hook. f. mô tả khoa học đầu tiên năm 1884.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Penstemon labrosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
2-(4-Hydroxyphenyl)-3-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5-[4,5,6-trihydroxy-3-(hydroxymethyl)oxan-2-yl]oxychromen-7-one	present	LOTUS
cyanidin-3,5-diglucoside	present	LOTUS
Pelargonin	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon labrosus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ531118.1 ↗603 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGCCGCAAGTCCCCCGTGCCGACGCCCCT …

Penstemon labrosus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Penstemon labrosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size772 620 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon labrosus0.77 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 102 records

Wild obs. + sensor665

Museum / vouchered437

Origin

Native104

Range

Area of Occupancy AOO1 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 363≤1 km 62≤10 km 23>10 km 4

452 georeferenced · 213 without coordinates

Open the mapobservation + sensor665

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 66≤1 km 109≤10 km 64>10 km 11

250 georeferenced · 187 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	129
San Diego, US	69
Riverside, US	57
Santa Barbara, US	33
Ensenada, MX	11
Bronx, US	10
US	10
Davis, US	9
Los Angeles, US	7
Phoenix, US	6
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	6
CASlocation not on record	6
San Bernardino, US	5
ASUlocation not on record	5
Arcata, US	4
Northridge, US	4
Logan, US	3
WTUlocation not on record	3
Mexico City, MX	3
Severin-McDaniel Insect Collectionlocation not on record	3
Canadian Department of Agriculturelocation not on record	3
San Luis Obispo, US	3
University of Stellenboschlocation not on record	3
La Paz, MX	2
Long Beach, US	2
Flagstaff, US	2
Arizona State University Biocollectionslocation not on record	2
San Jose, US	1
Dekalb, US	1
Kew, GB	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Mexico City, MX	1
Irvine, US	1
San Diego Natural History Museumlocation not on record	1
Pomona Collegelocation not on record	1
Frankfurt am Main	1
US	1
Wuzhou, CN	1
Wellington, NZ	1
Provo, US	1
Angwin, US	1

41 institutions · 414 of 437 vouchered records shown · 23 without an institution code

09Environmental DNA2 detections

Where the DNA of Penstemon labrosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Pine Oak woodland, open meadow; Quercus kell…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 18.5–18.5

Seasonal swing summer↔winter16.0 °C

Max temp (day)27.2 °C

Min temp (night)10.7 °C

Precipitation3.40 mm/mo

Air humidity37.6 %

Moisture balance-185 mm/mo

Vapour deficit1,331 Pa

Wind speed2.70 m/s

Cloud cover19.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Penstemon labrosus

At a glance

Sources11 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

Compound class profile1 class

Documented compounds4 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 102 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 41 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 102 records