Penstemon incertus

Brandegee · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records396

Data sources9

Biological traits12

DNA specimens3

eDNA detections1

Sources9 archives

Databases and archives Penstemon incertus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility396 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF396 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Penstemon incertus is a species of penstemon known by the common name Mojave beardtongue. It is endemic to California, where it can be found in many of the southeastern mountain ranges, including the southern reaches of the Sierra Nevada, the Tehachapis, and the mountains of the Mojave Desert region. It is a member of the flora in scrub and woodland, among Joshua Trees and in sandy washes. It is a rounded, branching, erect shrub reaching one meter in maximum height. The thick leaves are linear to lance-shaped with rolled, untoothed edges and reaching up to 7 centimeters. The glandular inflorescence produces several wide-mouthed tubular or funnel-shaped flowers measuring 2 to 3 centimeters long. The flowers are blue-purple, glandular on the outer surface and mostly hairless inside except for the hairy staminode.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.14 mg

Seed mass max2.14 mg

Seed mass min2.14 mg

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition3 compounds

Compounds documented for Penstemon incertus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins3

Documented compounds3 total

Tissue Source Quantified only

Compound	Class	Amount	Source
cyanidin-3,5-diglucoside		present	LOTUS
Delphinidin 3,5-diglucoside		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon incertus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ534941.1 ↗602 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACCTCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGCCCCT …

Penstemon incertus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type396 records

Wild obs. + sensor143

Museum / vouchered253

Origin

Native80

Range

Area of Occupancy AOO740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 85≤1 km 6≤10 km 11>10 km 3

105 georeferenced · 38 without coordinates

Open the mapobservation + sensor143

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 2≤1 km 67≤10 km 46>10 km 5

120 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence253

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	89
Riverside, US	45
US	15
Santa Barbara, US	14
CASlocation not on record	9
San Diego, US	7
San Luis Obispo, US	6
Los Angeles, US	5
Bronx, US	5
Davis, US	5
University of Stellenboschlocation not on record	3
Flagstaff, US	3
Irvine, US	3
Angwin, US	2
Northridge, US	2
Phoenix, US	2
US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Arcata, US	1
WTUlocation not on record	1
Pullman, US	1
Mexico City, MX	1
EL PASO, US	1
ASUlocation not on record	1

25 institutions · 224 of 253 vouchered records shown · 29 without an institution code

09Environmental DNA1 detections

Where the DNA of Penstemon incertus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Mixed montane Chaparral dominated by Adenost…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 16.8–16.8

Seasonal swing summer↔winter12.8 °C

Max temp (day)23.6 °C

Min temp (night)11.1 °C

Precipitation7.80 mm/mo

Air humidity57.6 %

Moisture balance-135 mm/mo

Vapour deficit814 Pa

Wind speed1.60 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)