Penstemon heterophyllus

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records2 389

Data sources8

Biological traits11

DNA specimens6

eDNA detections4

Sources8 archives

Databases and archives Penstemon heterophyllus's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF2 389 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.61 m

Seed mass0.491 mg

⚠ sources differ — TRY: 0.491 mg · GIFT: 0.461 mg

Seed mass max0.627 mg

Seed mass min0.4 mg

Life cycle & reproduction3

Dispersal typeunspecialized

Life formsubshrub

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

03Chemical composition3 compounds

Compounds documented for Penstemon heterophyllus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins3

Documented compounds3 total

Compound	Class	Amount	Source
cyanidin-3,5-diglucoside		present	LOTUS
Delphinidin 3,5-diglucoside		present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon heterophyllus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ471700.1 ↗339 bp

ACGT

GCATCGATTAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACCAAGTTAGCGCCCG …

Penstemon heterophyllus Catherine de la Mare 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcLaITS3ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 389 records

Wild obs. + sensor2 027

Museum / vouchered362

Origin

Native33

Range

Area of Occupancy AOO3 596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 247≤1 km 178≤10 km 82>10 km 56

1 563 georeferenced · 464 without coordinates

Open the mapobservation + sensor2 027

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 13≤1 km 122≤10 km 96>10 km 1

232 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence362

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	76
Riverside, US	41
Claremont, US	36
Davis, US	26
Arcata, US	18
Angwin, US	15
WTUlocation not on record	15
San Luis Obispo, US	13
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	8
Los Angeles, US	8
US	8
EL PASO, US	6
Northridge, US	5
San Jose, US	5
San Diego, US	4
Severin-McDaniel Insect Collectionlocation not on record	4
STNFlocation not on record	2
San Francisco, US	2
Flagstaff, US	2
Canadian Department of Agriculturelocation not on record	2
University of Stellenboschlocation not on record	2
Bloomington, US	2
ASUlocation not on record	2
Irvine, US	2
Fredericton Stock Culture Collectionlocation not on record	1
Turlock, US	1
Long Beach, US	1
Wellington, NZ	1
Chongqing Museumlocation not on record	1
Pullman, US	1
Henderson, US	1
Bangkok, TH	1
South Kensington, GB	1
CASlocation not on record	1
Vancouver, CA	1
Santa Cruz, US	1

36 institutions · 316 of 362 vouchered records shown · 46 without an institution code

09Environmental DNA4 detections

Where the DNA of Penstemon heterophyllus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Southern oak woodland.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 19.0–19.8

Seasonal swing summer↔winter14.5 °C

Max temp (day)27.6 °C 27.1–28.1

Min temp (night)12.7 °C 12.5–12.9

Precipitation3.20 mm/mo 3.00–3.40

Air humidity50.9 % 49.5–52.3

Moisture balance-171 mm/mo -179–-163

Vapour deficit1,121 Pa 1,065–1,176

Wind speed2.10 m/s 1.50–2.80

Cloud cover16.6 % 16.5–16.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources8 archives

Size & morphology4

Life cycle & reproduction3

Habitat & environment4

Compound class profile1 class

Documented compounds3 total

At a glance

Record type2 389 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions26 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 389 records