Penstemon heterodoxus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records885

Data sources8

Biological traits12

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Penstemon heterodoxus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility885 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF885 records

DNA & barcodingNCBIsequences

01Narrative

Penstemon heterodoxus is a species of penstemon known by the common name Sierra beardtongue. It is native to California and western Nevada where it grows in several of the mountain ranges from the Klamath Mountains to the Sierra Nevada - and the slopes and plateaus to the east. It grows in subalpine and alpine climates in mountain forests, meadows and talus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.147 mg

⚠ sources differ — TRY: 0.147 mg · GIFT: 0.138 mg

Seed mass max0.176 mg

Seed mass min0.1 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Forb/herb, Subshrub

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

03Chemical composition1 compounds

Compounds documented for Penstemon heterodoxus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins1

Documented compounds1 total

Compound	Class	Amount	Source
Delphinidin 3,5-diglucoside		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon heterodoxus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ531109.1 ↗602 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGCCGAGGCGCGAGGGTCGAAAGTCCCCCGCGCCGACGCCCCT …

Penstemon heterodoxus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type885 records

Wild obs. + sensor622

Museum / vouchered263

Origin

Native22

Range

Area of Occupancy AOO1 924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 343≤1 km 63≤10 km 30>10 km 19

455 georeferenced · 167 without coordinates

Open the mapobservation + sensor622

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 4≤1 km 109≤10 km 79>10 km 1

193 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence263

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	32
WTUlocation not on record	28
Claremont, US	21
Riverside, US	17
Los Angeles, US	13
Fredericton Stock Culture Collectionlocation not on record	12
San Jose, US	9
Angwin, US	9
San Diego, US	8
Arcata, US	8
Pullman, US	7
Northridge, US	7
San Luis Obispo, US	5
San Francisco, US	4
US	4
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	4
Flagstaff, US	3
Canadian Department of Agriculturelocation not on record	3
EL PASO, US	2
Mexico City, MX	2
Boise, US	2
STNFlocation not on record	1
CASlocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Mississippi State, US	1
Phoenix, US	1
Long Beach, US	1
Santa Barbara, US	1
INFlocation not on record	1
Truckee, US	1
Bloomington, US	1
Durango, US	1

32 institutions · 211 of 263 vouchered records shown · 52 without an institution code