Penstemon hartwegii

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records187

Data sources11

Biological traits92

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Penstemon hartwegii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources92 traits

Occurrence & distributionGBIF187 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Penstemon hartwegii, common name Hartweg's beardtongue, is a species of flowering perennial herb in the plantain family.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRYUSDA

Size & morphology2

Plant height1.22 m

Seed mass0.425 mg

Life cycle & reproduction24

After harvest regrowth rateRapid

Bloom periodLate Spring

Coppice potentialNo

Flower colourred

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endFall

Growth rate USDARapid

Life formsubshrub or shrub

Life spanShort

⚠ sources differ — TRY: Short · GIFT: perennial

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateRapid

Seedling vigorHigh

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment25

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatesubtropical

Climberself-supporting

Elevation mean2 600 m

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

Growth form USDAMultiple Stem

Hedge toleranceMedium

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min6 in

Shape and orientationErect

Small grainNo

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredYes

Drought toleranceNone

Fertility requirementLow

Fire resistantNo

Fire toleranceLow

Frost free days min120 days

Moisture useMedium

Nitrogen fixation levelNone

Precipitation max40 in

Precipitation min10 in

Protein potentialMedium

Salinity toleranceNone

Shade toleranceMedium

Soil pH max8 pH

Soil pH min6.8 pH

Temperature min-38 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalHigh

Palatable graze animalHigh

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound800 000 per lb

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousYes

Fruit seed persistenceNo

Planting density max2 700 per acre

Planting density min1 700 per acre

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon hartwegii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ471703.1 ↗276 bp

ACGT

CCATCGAGTCTTTGAACGCAAGTTGGCCAGAAGCCATTAGGCGAGGGCACGTCTGCATGGGCGTCACGCATCGCGTCGCCCCCATCCAAT …

Penstemon hartwegii Tubular Bells Rose 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Penstemon hartwegii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · Cave1963

CCDB · Cave1963 — Straw 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type187 records

Wild obs. + sensor18

Museum / vouchered161

Cultivated / captive1

Other7

Range

Area of Occupancy AOO408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 4≤1 km 5≤10 km 4>10 km 1

14 georeferenced · 4 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 102≤1 km 3≤10 km 11>10 km 5

121 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence161

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	51
Mexico City, MX	49
Saint Louis, US	7
Juriquilla, MX	7
Wuzhou, CN	7
Austin, US	6
ASUlocation not on record	5
Bronx, US	5
Universidad de La Salle (La Salle)location not on record	2
Ciudad de México, MX	2
Chapingo, MX	2
Mexico City, MX	2
Cambridge, US	1
Istituto Agrario Castelnuovolocation not on record	1
University of Zhejianglocation not on record	1
LDlocation not on record	1
Pullman, US	1
University of Stellenboschlocation not on record	1
La Paz, BO	1
Tapachula, MX	1
Oskarshamn, SE	1
EL PASO, US	1
Austin, US	1
Mississippi State, US	1
Puebla, MX	1
Northridge, US	1

26 institutions · 159 of 161 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Penstemon hartwegii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)