Penstemon gairdneri

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records481

Data sources8

Biological traits85

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Penstemon gairdneri's data was compiled from.

GBIFGlobal Biodiversity Information Facility481 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources85 traits

Occurrence & distributionGBIF481 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.3 m

Seed mass1.13 mg

⚠ sources differ — TRY: 1.13 mg · GIFT: 1.03 mg

Seed mass max0.93 mg

Seed mass min0.93 mg

Life cycle & reproduction24

After harvest regrowth rateSlow

Bloom periodLate Spring

Coppice potentialNo

Flower colourblue

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endSpring

Growth rate USDAModerate

Life formperennial

Life spanperennial

Lifespan categoryLong

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateNone

Habitat & environment22

Active growth periodSpring

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

BloatNone

Climatetemperate

Climberself-supporting

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formSubshrub, Forb/herb

Growth form USDASingle Crown

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min10 in

Shape and orientationErect

Small grainNo

Woodinessvariable

Physiology & chemistry18

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceLow

Frost free days min140 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max16 in

Precipitation min10 in

Salinity toleranceNone

Shade toleranceHigh

Soil pH max8 pH

Soil pH min6.3 pH

Temperature min-28 °F

Uses & economy13

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound400 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon gairdneri has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ531093.1 ↗578 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAAACAATCGGAGGGGCCGAGGCGCGAGGGTCGCAAGCCCCCCGCGCCGACGCA …

Penstemon gairdneri internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Penstemon gairdneri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — SPELLENBERG, R. 1967. In Documented chromosome numbers of plants. Madrono 19: 134="136.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type481 records

Wild obs. + sensor398

Museum / vouchered83

Range

Area of Occupancy AOO1 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 268≤1 km 22≤10 km 11>10 km 21

322 georeferenced · 76 without coordinates

Open the mapobservation + sensor398

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 6≤1 km 15≤10 km 35>10 km 6

62 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	36
Moscow, US	8
Cheney, US	6
Corvallis, US	5
Pocatello, US	4
University of Stellenboschlocation not on record	4
Tacoma, US	3
Boise, US	3
Provo, US	2
Bend, US	1
CASlocation not on record	1
Denver, US	1
Flagstaff, US	1
Phoenix, US	1
Bronx, US	1
Portland, US	1
Bangkok, TH	1
Pullman, US	1
Bloomington, US	1
Los Angeles, US	1

20 institutions · 82 of 83 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Penstemon gairdneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)