Penstemon floridus

Brandegee · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records206

Data sources9

Biological traits9

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Penstemon floridus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility206 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF206 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Penstemon floridus is a species of flowering plant in the plantain family known by the common names Panamint beardtongue and rose penstemon.Penstemon floridus. CalFlora. It is native to the lower mountain and plateau areas of the Mojave Desert, within eastern California and southwestern Nevada. It grows in canyons, arroyos, and sagebrush scrub.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed mass0.96 mg

Seed mass max0.96 mg

Seed mass min0.96 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

Woodinessvariable

03Chemical composition2 compounds

Compounds documented for Penstemon floridus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
cyanidin-3,5-diglucoside		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon floridus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ531090.1 ↗602 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGCCCCT …

Penstemon floridus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Penstemon floridus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · kew

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type206 records

Wild obs. + sensor143

Museum / vouchered63

Origin

Native11

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 91≤1 km 12≤10 km 10>10 km 5

118 georeferenced · 25 without coordinates

Open the mapobservation + sensor143

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤1 km 13≤10 km 18

31 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	12
Santa Barbara, US	11
Riverside, US	6
San Diego, US	5
WTUlocation not on record	4
Bronx, US	2
Arcata, US	2
Northridge, US	2
Angwin, US	2
EL PASO, US	1
Flagstaff, US	1
San Jose, US	1
CASlocation not on record	1
Wellington, NZ	1
San Francisco, US	1
Denver, US	1
Missoula, US	1
Canadian Department of Agriculturelocation not on record	1
Long Beach, US	1
Los Angeles, US	1

20 institutions · 57 of 63 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)