Penstemon fendleri — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Penstemon

At a glance

Occurrence records936

Data sources10

Biological traits12

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Penstemon fendleri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility936 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF936 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT592 Mbp

01Narrative

Penstemon fendleri là một loài thực vật có hoa trong họ Mã đề. Loài này được Torr. & A. Gray mô tả khoa học đầu tiên năm 1857.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.2 mg

Seed mass max1.2 mg

Seed mass min1.2 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition3 compounds

Compounds documented for Penstemon fendleri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins3

Documented compounds3 total

Compound	Class	Amount	Source
cyanidin-3,5-diglucoside		present	LOTUS
Delphinidin 3,5-diglucoside		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penstemon fendleri has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSDQ531089.1 ↗602 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTGTTTAAACATCGAGGGGTCGAGGCGCGAGGGTCGCAAGTCCCCCGTGCCGACGCCCCT …

Penstemon fendleri internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Penstemon fendleri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size591 690 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Penstemon fendleri0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Broderick SR, Stevens MR, Geary B, Love SL, Jellen EN, Dockter RB, Daley SL, Lindgren DT. 2011. A survey of Penstemon's genome size. Genome 54: 160-173.

n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Freeman, C. C. 1983. Chromosome numbers in Great Plains species of Penstemon (Scrophulariaceae). Brittonia 35(3): 232–238.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type936 records

Wild obs. + sensor499

Museum / vouchered437

Range

Area of Occupancy AOO2 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 260≤1 km 83≤10 km 35>10 km 39

417 georeferenced · 82 without coordinates

Open the mapobservation + sensor499

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 25≤1 km 65≤10 km 152>10 km 29

271 georeferenced · 166 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions33 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	88
Bronx, US	80
Wuzhou, CN	49
Fort Worth, US	42
Austin, US	30
EL PASO, US	30
ASUlocation not on record	12
Riverside, US	12
Claremont, US	7
Waverly, US	6
WTUlocation not on record	6
Lubbock, US	6
Saint Louis, US	6
Flagstaff, US	4
Pomona Collegelocation not on record	4
DOI/NPS, Colonial National Historical Parklocation not on record	4
DOI/NPS, Greenbelt Parklocation not on record	4
Provo, US	3
Phoenix, US	3
Bangkok, TH	3
San Angelo, US	3
BAYLUlocation not on record	3
University of Stellenboschlocation not on record	3
Bloomington, US	2
Stephenville, US	2
Mexico City, MX	2
Davis, US	2
San Luis Obispo, US	2
Pittsburg, US	2
Boise, US	1
Philadelphia, US	1
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	1
Chongqing Museumlocation not on record	1
Moscow, US	1
Long Beach, US	1
Tempe, US	1
Denton, US	1
Northridge, US	1
Chadron, US	1
USFSlocation not on record	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Madison, US	1
Ashland, US	1
Durango, US	1

44 institutions · 435 of 437 vouchered records shown · 2 without an institution code